Cyba<sup>em1Mcwi</sup> (cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Cybaem1Mcwi (cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Cybaem1Mcwi
Name: cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
RGD ID: 5131930
Description: This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 36-bp frameshift deletion in exon 1 (del 54-89).
Type: allele  of Cyba  
Previously known as: Cyba^[em1Mcwi]; Cybaem1Mcwi; cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
Is Marker For: Strains:   SS-Cybaem1Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map19 RGD


References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Cybaem1Mcwi-var1 chr19 55257747 55257782 CAGCGCCTGTTCGTTGGCCCACATGGCCCACTCGAT - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Cybaem1Mcwi
SS-Cybaem1Mcwi    


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_024160 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-08-28 Cybaem1Mcwi  cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin  Cybaem1Mcwi  cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin  Name changed 629549 APPROVED