Mir1264 (microRNA 1264) - Rat Genome Database

Name: Mir1264
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir1264 (microRNA 1264) Mus musculus

Analyze

Symbol:

Mir1264

Name:

microRNA 1264

RGD ID:

4888692

MGI Page

MGI

Description:

Orthologous to human MIR1264 (microRNA 1264).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-1264; mmu-mir-1264

RGD Orthologs

Human

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	145,793,597 - 145,793,682 (+)	NCBI	GRCm39		mm39
GRCm38	X	147,010,601 - 147,010,686 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	147,010,601 - 147,010,686 (+)	Ensembl	GRCm38		mm10	GRCm38
Celera	X	130,950,815 - 130,950,900 (+)	NCBI		Celera
Cytogenetic Map	X	F2	NCBI
cM Map	X	68.46	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

autistic disorder (ISO)

schizophrenia (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

radon atom (ISO)

radon(0) (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:16954537	PMID:20413612	PMID:21037258

Genomics

Comparative Map Data

Mir1264
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	145,793,597 - 145,793,682 (+)	NCBI	GRCm39		mm39
GRCm38	X	147,010,601 - 147,010,686 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	147,010,601 - 147,010,686 (+)	Ensembl	GRCm38		mm10	GRCm38
Celera	X	130,950,815 - 130,950,900 (+)	NCBI		Celera
Cytogenetic Map	X	F2	NCBI
cM Map	X	68.46	NCBI

MIR1264
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	X	114,652,655 - 114,652,723 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	X	114,652,655 - 114,652,723 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	X	113,887,130 - 113,887,198 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Celera	X	114,322,328 - 114,322,396 (+)	NCBI
Cytogenetic Map	X	q23	NCBI
HuRef	X	103,473,343 - 103,473,411 (+)	NCBI		HuRef
CHM1_1	X	113,798,064 - 113,798,132 (+)	NCBI		CHM1_1

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357433	Dbts2_m	diabetes 2 (mouse)			Not determined		X	7360056	151324042	Mouse
13824980	Ferq1_m	genetic fertility QTL 1 (mouse)					X	55000000	150000000	Mouse
13208552	Wght12_m	weight 12 (mouse)					X	95000000	151000000	Mouse
13208556	Lgth14_m	body length 14 (mouse)					X	95000000	151000000	Mouse
1357823	Spha3_m	sperm head anomaly 3 (mouse)			Not determined		X	103012242	163975945	Mouse
1301209	Cia19_m	collagen induced arthritis 19 (mouse)			Not determined		X	122083468	161430042	Mouse
25314309	Syncl5_m	synaptonemal complex length 5 (mouse)					X	123000000	153800000	Mouse
10412164	Cmv2_m	cytomegalovirus resistance 2 (mouse)			Not determined		X	126902153	160902273	Mouse
13824981	Svwq2_m	seminal vesicle weight QTL 2 (mouse)					X	130000000	155000000	Mouse
1558900	Bw3_m	body weight QTL 3 (mouse)			Not determined		X	134639291	166515599	Mouse
1301276	Tswt_m	testis weight (mouse)			Not determined		X	139475662	152006342	Mouse
1302000	Pgia25_m	proteoglycan induced arthritis 2 (mouse)			Not determined		X	145691384	171031299	Mouse
10401118	Pgia39_m	proteoglycan induced arthritis 39 (mouse)			Not determined		X	145691384	171031299	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	26667
Count of gene targets:	12098
Count of transcripts:	20792
Interacting mature miRNAs:	mmu-miR-1264-3p, mmu-miR-1264-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_037205	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BX005219	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609649	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000175381

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	X	147,010,601 - 147,010,686 (+)	Ensembl

RefSeq Acc Id:

NR_037205

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	X	145,793,597 - 145,793,682 (+)	NCBI
GRCm38	X	147,010,601 - 147,010,686 (+)	ENTREZGENE
Celera	X	130,950,815 - 130,950,900 (+)	ENTREZGENE
cM Map	X		ENTREZGENE

Sequence:

show sequence

CCTGGCATATAGCAGGTCCTCAATAAGTATTTGTTGAAAAAATAAATGAAGCAACAAATCTTAT
TTGAGCACCTGTTATGTGGAGG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:4834216	AgrOrtholog
Ensembl Genes	ENSMUSG00000093122	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000175381	ENTREZGENE
MGD	MGI:4834216	ENTREZGENE
miRBase	MI0004130	ENTREZGENE
NCBI Gene	100526460	ENTREZGENE
PhenoGen	Mir1264	PhenoGen
RNAcentral	URS00003205EB	RNACentral
	URS0000618F01	RNACentral
	URS000075C7EE	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar