Foxo4<sup>em1Soar</sup> (forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Foxo4em1Soar (forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar) Rattus norvegicus
Analyze
Symbol: Foxo4em1Soar
Name: forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar
RGD ID: 405855878
Description: This Foxo4 mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.
ASSOCIATED WITH abnormal placenta junctional zone morphology; increased placenta weight; increased placental labyrinth size
Type: allele  of Foxo4  
Previously known as: Foxo4^[em1Soar]
Is Marker For: Strains:   SD-Foxo4em1Soar  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. The AKT1-FOXO4 axis reciprocally regulates hemochorial placentation. Kozai K, etal., Development. 2023 Jan 15;150(2):dev201095. doi: 10.1242/dev.201095. Epub 2023 Jan 17.

Genomics


Related Rat Strains
The following Strains have been annotated to Foxo4em1Soar


Expression

RNA-SEQ Expression


Sequence

Nucleotide Sequences


Additional Information