Advanced Search (OLGA)

Gene: LOC107987046 (uncharacterized LOC107987046) Homo sapiens

Analyze

Symbol:

LOC107987046

Name:

uncharacterized LOC107987046

RGD ID:

38668789

Description:

Type:

ncrna

RefSeq Status:

MODEL

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	6,228,232 - 6,328,268 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
Cytogenetic Map	9	p24.1	NCBI
CHM1_1	9	6,228,703 - 6,329,067 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	9	6,233,292 - 6,333,332 (-)	NCBI		T2T-CHM13v2.0

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

References

Genomics

Variants

Variants in LOC107987046
50 total Variants

QTLs in Region (GRCh38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
628426103	GWAS2334332_H	atopic asthma QTL GWAS2334332 (human)		2e-31	atopic asthma		9	6305904	6305905	Human
617127116	GWAS2144615_H	erythrocyte count QTL GWAS2144615 (human)		2e-13	erythrocyte count		9	6317936	6317937	Human
617042370	GWAS2059869_H	wheezing QTL GWAS2059869 (human)		7e-10	wheezing		9	6292798	6292799	Human
597310620	GWAS1406694_H	creatinine measurement QTL GWAS1406694 (human)		3e-09	creatinine measurement		9	6327690	6327691	Human
628822129	GWAS2730358_H	asthma QTL GWAS2730358 (human)		5e-21	asthma		9	6255967	6255968	Human
626446940	GWAS2260873_H	eosinophil count QTL GWAS2260873 (human)		7e-15	eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	9	6295587	6295588	Human
628426104	GWAS2334333_H	atopic asthma QTL GWAS2334333 (human)		1e-12	atopic asthma		9	6252690	6252691	Human
597074055	GWAS1170129_H	childhood onset asthma QTL GWAS1170129 (human)		3e-08	childhood onset asthma		9	6231239	6231240	Human
2302773	MAMTS18_H	Mammary tumor susceptibility QTL 18 (human)		0.039	Mammary tumor susceptibility		9	5289149	31289149	Human
617092319	GWAS2109818_H	hemoglobin measurement QTL GWAS2109818 (human)		3e-09	hemoglobin measurement		9	6261695	6261696	Human
406925657	GWAS574633_H	atopic asthma QTL GWAS574633 (human)		2e-31	atopic asthma		9	6305904	6305905	Human
616952284	GWAS1969783_H	glycodeoxycholate measurement QTL GWAS1969783 (human)		0.000005	glycodeoxycholate measurement		9	6278071	6278072	Human
406925658	GWAS574634_H	atopic asthma QTL GWAS574634 (human)		1e-12	atopic asthma		9	6252690	6252691	Human
597282437	GWAS1378511_H	hemoglobin measurement QTL GWAS1378511 (human)		3e-09	hemoglobin measurement		9	6261695	6261696	Human
597079477	GWAS1175551_H	red blood cell density measurement QTL GWAS1175551 (human)		2e-22	red blood cell density measurement		9	6309188	6309189	Human
407152224	GWAS801200_H	childhood onset asthma QTL GWAS801200 (human)		1e-10	childhood onset asthma		9	6255967	6255968	Human
407152226	GWAS801202_H	childhood onset asthma QTL GWAS801202 (human)		6e-14	childhood onset asthma		9	6236407	6236408	Human
597412284	GWAS1508358_H	atopic asthma QTL GWAS1508358 (human)		2e-31	atopic asthma		9	6305904	6305905	Human
628429149	GWAS2337378_H	eosinophil count QTL GWAS2337378 (human)		1e-56	eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	9	6252690	6252691	Human
406964840	GWAS613816_H	neutrophil percentage of granulocytes QTL GWAS613816 (human)		8e-23	neutrophil percentage of granulocytes		9	6288604	6288605	Human
597084346	GWAS1180420_H	adult onset asthma QTL GWAS1180420 (human)		2e-09	adult onset asthma		9	6255967	6255968	Human
628596826	GWAS2505055_H	prostate carcinoma QTL GWAS2505055 (human)		2e-08	prostate integrity trait (VT:0010571)		9	6253301	6253302	Human
628820822	GWAS2729051_H	hemoglobin measurement QTL GWAS2729051 (human)		3e-09	blood hemoglobin amount (VT:0001588)	hemoglobin measurement (CMO:0000508)	9	6261695	6261696	Human
616525969	GWAS1922552_H	serum creatinine amount QTL GWAS1922552 (human)		9e-15	serum creatinine amount		9	6289504	6289505	Human
628829003	GWAS2737232_H	erythrocyte count QTL GWAS2737232 (human)		2e-13	erythrocyte count	red blood cell count (CMO:0000025)	9	6317936	6317937	Human
628813643	GWAS2721872_H	serum creatinine amount QTL GWAS2721872 (human)		3e-09	serum creatinine amount		9	6327690	6327691	Human
406969715	GWAS618691_H	eosinophil percentage of leukocytes QTL GWAS618691 (human)		9e-28	eosinophil percentage of leukocytes		9	6288604	6288605	Human
407120758	GWAS769734_H	eosinophil count QTL GWAS769734 (human)		7e-15	eosinophil count		9	6295587	6295588	Human
597030822	GWAS1126896_H	asthma, allergic disease QTL GWAS1126896 (human)		2e-08	asthma, allergic disease		9	6233082	6233083	Human
596989857	GWAS1109376_H	memory performance QTL GWAS1109376 (human)		0.00001	memory performance		9	6236350	6236351	Human
616518795	GWAS1915378_H	asthma QTL GWAS1915378 (human)		5e-21	asthma		9	6255967	6255968	Human
407125628	GWAS774604_H	eosinophil count QTL GWAS774604 (human)		3e-26	eosinophil count		9	6263444	6263445	Human
407218815	GWAS867791_H	asthma exacerbation measurement QTL GWAS867791 (human)		3e-10	asthma exacerbation measurement		9	6308729	6308730	Human
407149433	GWAS798409_H	asthma QTL GWAS798409 (human)		4e-11	asthma		9	6255967	6255968	Human
407337594	GWAS986570_H	hematocrit QTL GWAS986570 (human)		2e-09	hematocrit		9	6261695	6261696	Human
628441672	GWAS2349901_H	eosinophil percentage of leukocytes QTL GWAS2349901 (human)		3e-11	eosinophil quantity (VT:0002602)	blood eosinophil count to total leukocyte count ratio (CMO:0000369)	9	6265256	6265257	Human
407309177	GWAS958153_H	hemoglobin measurement QTL GWAS958153 (human)		3e-09	hemoglobin measurement		9	6261695	6261696	Human
628440631	GWAS2348860_H	childhood onset asthma QTL GWAS2348860 (human)		1e-10	childhood onset asthma		9	6255967	6255968	Human
616953217	GWAS1970716_H	eosinophil count QTL GWAS1970716 (human)		3e-26	eosinophil count		9	6263444	6263445	Human
628515891	GWAS2424120_H	Wheezing QTL GWAS2424120 (human)		7e-10	Wheezing		9	6292798	6292799	Human
617089935	GWAS2107434_H	hematocrit QTL GWAS2107434 (human)		2e-09	hematocrit		9	6261695	6261696	Human
616982913	GWAS2000412_H	eosinophil percentage of granulocytes QTL GWAS2000412 (human)		3e-27	eosinophil quantity (VT:0002602)		9	6288604	6288605	Human
616521462	GWAS1918045_H	eosinophil percentage of leukocytes QTL GWAS1918045 (human)		5e-81	eosinophil percentage of leukocytes		9	6292798	6292799	Human
628424254	GWAS2332483_H	adult onset asthma QTL GWAS2332483 (human)		2e-09	adult onset asthma		9	6255967	6255968	Human
617041549	GWAS2059048_H	serum creatinine amount QTL GWAS2059048 (human)		3e-09	serum creatinine amount		9	6327690	6327691	Human
617125507	GWAS2143006_H	eosinophil percentage of leukocytes QTL GWAS2143006 (human)		5e-81	eosinophil percentage of leukocytes		9	6292798	6292799	Human
628440633	GWAS2348862_H	childhood onset asthma QTL GWAS2348862 (human)		6e-14	childhood onset asthma		9	6236407	6236408	Human
628814902	GWAS2723131_H	eosinophil count QTL GWAS2723131 (human)		5e-52	eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	9	6292798	6292799	Human
628702772	GWAS2611001_H	uromodulin measurement QTL GWAS2611001 (human)		4e-16	uromodulin measurement		9	6284723	6284724	Human
616977814	GWAS1995313_H	neutrophil percentage of granulocytes QTL GWAS1995313 (human)		8e-23	neutrophil quantity (VT:0000222)		9	6288604	6288605	Human
617095067	GWAS2112566_H	asthma QTL GWAS2112566 (human)		5e-21	asthma		9	6255967	6255968	Human
617123739	GWAS2141238_H	serum creatinine amount QTL GWAS2141238 (human)		9e-15	serum creatinine amount		9	6289504	6289505	Human
628821027	GWAS2729256_H	eosinophil percentage of leukocytes QTL GWAS2729256 (human)		5e-81	eosinophil quantity (VT:0002602)	blood eosinophil count to total leukocyte count ratio (CMO:0000369)	9	6292798	6292799	Human
2315898	GLUCO191_H	Glucose level QTL 191 (human)	1.83		Glucose level		9	5289149	31289149	Human
617106833	GWAS2124332_H	asthma QTL GWAS2124332 (human)		5e-25	asthma		9	6282511	6282512	Human
626441739	GWAS2255672_H	eosinophil count QTL GWAS2255672 (human)		3e-26	eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	9	6263444	6263445	Human
407191322	GWAS840298_H	wheezing QTL GWAS840298 (human)		7e-10	wheezing		9	6292798	6292799	Human
597047030	GWAS1143104_H	childhood onset asthma QTL GWAS1143104 (human)		1e-10	childhood onset asthma		9	6255967	6255968	Human
407137061	GWAS786037_H	asthma, allergic disease QTL GWAS786037 (human)		2e-08	asthma, allergic disease		9	6233082	6233083	Human
407363361	GWAS1012337_H	creatinine measurement QTL GWAS1012337 (human)		3e-09	creatinine measurement		9	6327690	6327691	Human
597051643	GWAS1147717_H	eosinophil count QTL GWAS1147717 (human)		1e-56	eosinophil count		9	6252690	6252691	Human
628832790	GWAS2741019_H	serum creatinine amount QTL GWAS2741019 (human)		9e-15	serum creatinine amount		9	6289504	6289505	Human
597047032	GWAS1143106_H	childhood onset asthma QTL GWAS1143106 (human)		6e-14	childhood onset asthma		9	6236407	6236408	Human
628486404	GWAS2394633_H	childhood onset asthma QTL GWAS2394633 (human)		3e-08	childhood onset asthma		9	6231239	6231240	Human
616505805	GWAS1902388_H	uromodulin measurement QTL GWAS1902388 (human)		4e-16	uromodulin measurement		9	6284723	6284724	Human
626444069	GWAS2258002_H	eosinophil count QTL GWAS2258002 (human)		1e-56	eosinophil count		9	6252690	6252691	Human
625815614	GWAS2236536_H	prostate carcinoma QTL GWAS2236536 (human)		2e-08	prostate carcinoma		9	6253301	6253302	Human
597427946	GWAS1524020_H	urate measurement QTL GWAS1524020 (human)		3e-08	urate measurement		9	6274892	6274893	Human
616990129	GWAS2007628_H	urate measurement QTL GWAS2007628 (human)		3e-08	urate measurement		9	6274892	6274893	Human
616982462	GWAS1999961_H	basophil count, eosinophil count QTL GWAS1999961 (human)		1e-22	eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	9	6264551	6264552	Human
628419853	GWAS2328082_H	hemoglobin measurement QTL GWAS2328082 (human)		3e-09	blood hemoglobin amount (VT:0001588)	hemoglobin measurement (CMO:0000508)	9	6262458	6262459	Human
407221052	GWAS870028_H	eosinophil percentage of leukocytes QTL GWAS870028 (human)		3e-11	eosinophil percentage of leukocytes		9	6265256	6265257	Human
616517830	GWAS1914413_H	eosinophil count QTL GWAS1914413 (human)		5e-52	eosinophil count		9	6292798	6292799	Human
407342393	GWAS991369_H	erythrocyte count QTL GWAS991369 (human)		5e-10	erythrocyte count		9	6233221	6233222	Human
628441610	GWAS2349839_H	eosinophil percentage of leukocytes QTL GWAS2349839 (human)		2e-58	eosinophil quantity (VT:0002602)	blood eosinophil count to total leukocyte count ratio (CMO:0000369)	9	6252690	6252691	Human
616987200	GWAS2004699_H	red blood cell density QTL GWAS2004699 (human)		2e-22	red blood cell density		9	6309188	6309189	Human
407226306	GWAS875282_H	basophil count, eosinophil count QTL GWAS875282 (human)		1e-22	basophil count, eosinophil count		9	6264551	6264552	Human
406967755	GWAS616731_H	eosinophil percentage of granulocytes QTL GWAS616731 (human)		3e-27	eosinophil percentage of granulocytes		9	6288604	6288605	Human
407141835	GWAS790811_H	childhood onset asthma QTL GWAS790811 (human)		3e-08	childhood onset asthma		9	6231239	6231240	Human
597296405	GWAS1392479_H	hematocrit QTL GWAS1392479 (human)		2e-09	hematocrit		9	6261695	6261696	Human
597045764	GWAS1141838_H	hemoglobin measurement QTL GWAS1141838 (human)		3e-09	hemoglobin measurement		9	6262458	6262459	Human
407036628	GWAS685604_H	adult onset asthma QTL GWAS685604 (human)		2e-09	adult onset asthma		9	6255967	6255968	Human
406943702	GWAS592678_H	eosinophil percentage of leukocytes QTL GWAS592678 (human)		2e-58	eosinophil percentage of leukocytes		9	6252690	6252691	Human
628692960	GWAS2601189_H	erythrocyte count QTL GWAS2601189 (human)		5e-10	erythrocyte count	red blood cell count (CMO:0000025)	9	6233221	6233222	Human
2293433	PRSTS223_H	Prostate tumor susceptibility QTL 223 (human)	1.6		Prostate tumor susceptibility		9	5289149	31289149	Human
617114963	GWAS2132462_H	uromodulin measurement QTL GWAS2132462 (human)		4e-16	uromodulin measurement		9	6284723	6284724	Human
617011802	GWAS2029301_H	eosinophil count QTL GWAS2029301 (human)		7e-15	eosinophil count		9	6295587	6295588	Human
628536555	GWAS2444784_H	hematocrit QTL GWAS2444784 (human)		2e-09	erythrocyte morphology trait (VT:0002447)	hematocrit (CMO:0000037)	9	6261695	6261696	Human
616953444	GWAS1970943_H	eosinophil percentage of leukocytes QTL GWAS1970943 (human)		9e-28	eosinophil quantity (VT:0002602)	blood eosinophil count to total leukocyte count ratio (CMO:0000369)	9	6288604	6288605	Human
617049701	GWAS2067200_H	eosinophil percentage of leukocytes QTL GWAS2067200 (human)		3e-11	eosinophil percentage of leukocytes		9	6265256	6265257	Human
597204541	GWAS1300615_H	asthma QTL GWAS1300615 (human)		4e-18	asthma		9	6252690	6252691	Human
407009253	GWAS658229_H	hemoglobin measurement QTL GWAS658229 (human)		3e-09	hemoglobin measurement		9	6262458	6262459	Human
616986998	GWAS2004497_H	hemoglobin measurement QTL GWAS2004497 (human)		3e-09	hemoglobin measurement		9	6262458	6262459	Human
628568007	GWAS2476236_H	urate measurement QTL GWAS2476236 (human)		3e-08	urate measurement	blood uric acid level (CMO:0000501)	9	6274892	6274893	Human
597052455	GWAS1148529_H	asthma QTL GWAS1148529 (human)		4e-11	asthma		9	6255967	6255968	Human
597098790	GWAS1194864_H	asthma exacerbation measurement QTL GWAS1194864 (human)		3e-10	asthma exacerbation measurement		9	6308729	6308730	Human
597333550	GWAS1429624_H	asthma QTL GWAS1429624 (human)		5e-25	asthma		9	6282511	6282512	Human
406916598	GWAS565574_H	asthma QTL GWAS565574 (human)		5e-25	asthma		9	6282511	6282512	Human
626444014	GWAS2257947_H	obsolete_wheezing QTL GWAS2257947 (human)		7e-10	obsolete_wheezing		9	6292798	6292799	Human
2293400	PRSTS224_H	Prostate tumor susceptibility QTL 224 (human)	1.62		Prostate tumor susceptibility		9	5289149	31289149	Human
597135148	GWAS1231222_H	memory performance QTL GWAS1231222 (human)		0.00001	learning/memory/conditioning trait (VT:0002063)		9	6236350	6236351	Human
598015256	GWAS1734555_H	red blood cell density QTL GWAS1734555 (human)		2e-22	red blood cell density		9	6309188	6309189	Human
628364215	GWAS2285059_H	Wheezing QTL GWAS2285059 (human)		7e-10	Wheezing		9	6292798	6292799	Human
407257997	GWAS906973_H	asthma QTL GWAS906973 (human)		4e-18	asthma		9	6252690	6252691	Human
617029910	GWAS2047409_H	asthma exacerbation measurement QTL GWAS2047409 (human)		3e-10	bronchoconstriction trait (VT:0001945)		9	6308729	6308730	Human
597242442	GWAS1338516_H	wheezing QTL GWAS1338516 (human)		7e-10	wheezing		9	6292798	6292799	Human
628860058	GWAS2768287_H	asthma QTL GWAS2768287 (human)		5e-25	asthma		9	6282511	6282512	Human
616987431	GWAS2004930_H	atopic asthma QTL GWAS2004930 (human)		2e-31	atopic asthma		9	6305904	6305905	Human
407022496	GWAS671472_H	endometriosis QTL GWAS671472 (human)		0.0000009	uterus integrity trait (VT:0010575)		9	6253571	6253572	Human
617123371	GWAS2140870_H	eosinophil count QTL GWAS2140870 (human)		5e-52	eosinophil count		9	6292798	6292799	Human
628464531	GWAS2372760_H	asthma QTL GWAS2372760 (human)		4e-18	asthma		9	6252690	6252691	Human
407277728	GWAS926704_H	asthma QTL GWAS926704 (human)		7e-17	asthma		9	6255967	6255968	Human
1357299	AASTH47_H	Allergic/atopic asthma related QTL 47 (human)		0.00028	Reversible airflow obstruction		9	5289149	31289149	Human
628622740	GWAS2530969_H	asthma, allergic disease QTL GWAS2530969 (human)		2e-08	asthma, allergic disease		9	6233082	6233083	Human
407148203	GWAS797179_H	glycodeoxycholate measurement QTL GWAS797179 (human)		0.000005	glycodeoxycholate measurement		9	6278071	6278072	Human
407064236	GWAS713212_H	red blood cell density measurement QTL GWAS713212 (human)		2e-22	red blood cell density measurement		9	6309188	6309189	Human
597046118	GWAS1142192_H	atopic asthma QTL GWAS1142192 (human)		1e-12	atopic asthma		9	6252690	6252691	Human
407057073	GWAS706049_H	eosinophil count QTL GWAS706049 (human)		1e-56	eosinophil count		9	6252690	6252691	Human
1643245	BW137_H	Body weight QTL 137 (human)	2.28		Body weight		9	5289149	31289149	Human
597304943	GWAS1401017_H	erythrocyte count QTL GWAS1401017 (human)		5e-10	erythrocyte count		9	6233221	6233222	Human
616553800	GWAS1950383_H	erythrocyte count QTL GWAS1950383 (human)		2e-13	erythrocyte count		9	6317936	6317937	Human
628436620	GWAS2344849_H	asthma QTL GWAS2344849 (human)		4e-11	asthma		9	6255967	6255968	Human
598091101	GWAS1810400_H	serum creatinine amount QTL GWAS1810400 (human)		3e-09	serum creatinine amount		9	6327690	6327691	Human

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	XR_001746613	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_001746614	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_007079896	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_007079897	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL133480	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL353741	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL360221	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CP068269	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XR_001746613

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	9	6,280,942 - 6,328,268 (-)	NCBI

Sequence:

show sequence

TAGAATCAGTGCTCAGCTGAGGCGCAACCCACACTGGCGGCATTTTGGCATTGCGAGGACCTCC
TGAGGGGCCAGAGCTGGACCATTTTCACAGATGAAACTCAGCCAAGCTGTTTAATGCTTCCTTC
GTATGTTTGGAAAAGTAATAAAAGGTCCACAGGAACATCCAAGGCTCAAGTTTTGAATGTCTAC
ATGTCATGAAGTTAACTGGAAAAAAAAAAAAAAAAAGAAGTTAACTGGCACTAGTGGAATGTCG
ATTACTGAAGATGAACCCCTAGACACATTCAGCAAGACATTCAACTTGCAGAAGGCAGGGAATT
TGGAGTGGTACACAATCAGATAACAAGGTTTCAAGCTCTAGTCGAAGACAAGATGATATTATAC
CTAAATAACAATTTCTAAGGAACTTGAATAACAATCTCTAAGGACTCTTGTCACTATATGAAGA
ACTTAAGTTAATGGCTCCATAATCTTAATTAAAAGGACAGCCATTTAATCAATTTTCTGCAGTG
AATTATTAGACTAACTTCCTAGCATCTGGAGATTACAGTATGTTCCACCTTGAAGCTATCACAA
TCAAGACTATTACCTGACATGCATTCAACAAATATTCGATGACAAACAAAGTATAAGGTTAATT
AATTATAAGGTTACAGAAAGTTAGGTCTCCTAACACCTAAGTGTTAAGTGGACTCAATGTTGAA
CCTTTTTGAGTGCCAACATGACACTCAAAGGAAATGCTCATGAACATTTCAGATTTCAGATTTG
GGATGCCCAACTGGTAAGTATAACACAAATATTCCAAACTTTGAAAAAAATTATGAAATCTGAA
ATACTTCTTGTCCCAAGCATTTTTTGGAAAAGGGATACTCAACCTGTACCTTATAACTTCCTTA
TAACTTTTGGCTCTACCACTTCTATCCCTATATGGAAGCTGAAGTATGTTATTACTGCTGTTAC
ATGACTATTTTTCTACATTGTGGTTCTATTTCTGCTAAATTATTCTTACAGTCTTTATCAATTT
AAGTTTTTTAAAAAACTGCCTTTTTAGAACTCTGAAACAGTATTTAAAAATTAAATTAAAAAAA
TTTTAAGTTTTGTTCATCATATACAATACAATTCTGATATATGATGTTAGACAAATTATTAGCC
AGGTAATTTCTGTTCACCTAGTATCAATGCTATAAAGAGCTTCAAGTGAACTTTCTTTAGTGAG
ATGAGTTTCAATGATCCTAAAGATGGTAAATGAACCATTATTTGTGTGTCTAAAGTGTGTACTC
TTAAGAAATTATCCATAAATCAAAAACAAAAATTTAAGCAATTGTTAAATATAATGTTAACAGG
AACATTGAGCAATAAATTGAAACTTTTAAATTTAACTCATATCTGCTTAGTTTTTTATTTAGTT
AAGTATAAAGGCCCAGTTAATTAATCAATTCATTAGATTGGTCAAGGCATGACAC

hide sequence

RefSeq Acc Id:

XR_001746614

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	9	6,228,232 - 6,328,268 (-)	NCBI

Sequence:

show sequence

TAGAATCAGTGCTCAGCTGAGGCGCAACCCACACTGGCGGCATTTTGGCATTGCGAGGACCTCC
TGAGGGGCCAGAGCTGGACCATTTTCACAGATGAAACTCAGCCAAGCTGTTTAATGCTTCCTTC
GTATGTTTGGAAAAGTAATAAAAGAGTCTTGGTCTGTAACCAGGACTGAAGTGCACAGCTGATT
GCAACCTTGAACTCCTGGCCTCAAGTGATCCTCCTGCCTTGGTCACCCAAAGTGCTTGGATTAG
AGGTATGAGCCACCATGCCTAGCTCTCCTGTATTTTTTACAATTAGCCCTTATATAGTGTTTAC
TATGTGCCAAGAACTGTACTAAGTGCTTCACATATTTAACTTATTCAATTATTACAGCAATCTT
GTTAGGGTAGCATTATTATTATCCCTCTTTTATATATGAGGAAACTGAGGTACAGAGGGATCAA
GTAAATGCCCAAGGCCTCATAGCTGAAACCCTAAGCGAACATTTTCAGAGTTCATGAGGTACTT
CAGGAAAGGGGTGGAGGAATCCAAA

hide sequence

RefSeq Acc Id:

XR_007079896

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
T2T-CHM13v2.0	9	6,285,996 - 6,333,332 (-)	NCBI

RefSeq Acc Id:

XR_007079897

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
T2T-CHM13v2.0	9	6,233,292 - 6,333,332 (-)	NCBI

Additional Information

External Database Links

Database	Acc Id	Source(s)
COSMIC	LOC107987046	COSMIC
GTEx	LOC107987046	GTEx
Human Proteome Map	LOC107987046	Human Proteome Map
NCBI Gene	LOC107987046	ENTREZGENE

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message