Il2rg<sup>em1Iexas</sup> (interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant1, Iexas) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Il2rgem1Iexas (interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant1, Iexas) Rattus norvegicus
Analyze
Symbol: Il2rgem1Iexas
Name: interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant1, Iexas
RGD ID: 38599192
Description: This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome
Type: allele  of Il2rg  
Is Marker For: Strains:   F344-Il2rgem1IexasRag2em1Iexas  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


References

Genomics


Related Rat Strains
The following Strains have been annotated to Il2rgem1Iexas


Expression


Sequence

Nucleotide Sequences


Additional Information