Mir19b2 (microRNA 19b-2) - Rat Genome Database

Name: Mir19b2
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir19b2 (microRNA 19b-2) Rattus norvegicus

Analyze

Symbol:

Mir19b2

Name:

microRNA 19b-2

RGD ID:

2325599

Description:

Predicted to enable mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including cholesterol homeostasis; negative regulation of apolipoprotein A-I-mediated signaling pathway; and regulation of protein metabolic process. Predicted to act upstream of or within several processes, including cellular response to leukemia inhibitory factor; long-term synaptic potentiation; and negative regulation of B cell apoptotic process. Predicted to be located in blood microparticle. Predicted to be part of RISC complex. Orthologous to human MIR19B2 (microRNA 19b-2); INTERACTS WITH cadmium atom; cadmium dichloride; rotenone.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-19b-2; Mir19b-2; rno-mir-19b-2

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	X	132,422,072 - 132,422,167 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	X	132,422,072 - 132,422,167 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	X	134,584,480 - 134,584,575 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	X	138,166,421 - 138,166,516 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	X	135,732,125 - 135,732,220 (-)	NCBI	Rnor_WKY
Rnor_6.0	X	140,117,379 - 140,117,474 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	140,117,379 - 140,117,474 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	X	140,167,226 - 140,167,321 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	X	131,322,287 - 131,322,382 (-)	NCBI		Celera
Cytogenetic Map	X	q36	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

autistic disorder (ISO)

HRPT-related hyperuricemia (ISO)

syndromic X-linked intellectual disability Lubs type (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

buta-1,3-diene (ISO)

cadmium atom (EXP,ISO)

cadmium dichloride (EXP)

rotenone (EXP)

silver atom (ISO)

silver(0) (ISO)

tributyl phosphate (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

B cell apoptotic process (ISO)

cellular response to bacterial lipopeptide (ISO)

cellular response to leukemia inhibitory factor (ISO)

cellular senescence (ISO)

cholesterol homeostasis (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

negative regulation of apolipoprotein A-I-mediated signaling pathway (ISO)

negative regulation of apoptotic process (ISO)

negative regulation of B cell apoptotic process (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of coagulation (ISO)

negative regulation of G2/M transition of mitotic cell cycle (ISO)

negative regulation of gene expression (ISO)

negative regulation of inflammatory response to antigenic stimulus (ISO)

negative regulation of interleukin-6 production (ISO)

negative regulation of matrix metallopeptidase secretion (ISO)

negative regulation of serine-type endopeptidase activity (ISO)

positive regulation of cell growth involved in cardiac muscle cell development (ISO)

positive regulation of tyrosine phosphorylation of STAT protein (ISO)

response to bacterium (ISO)

Cellular Component

blood microparticle (ISO)

RISC complex (ISO)

Molecular Function

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:14691248	PMID:16381832	PMID:16766679	PMID:17604727	PMID:18329372	PMID:20403161	PMID:20439489	PMID:23185045	PMID:24205035	PMID:25650006	PMID:25751060	PMID:25858512
PMID:33332749	PMID:36539014

Genomics

Comparative Map Data

Mir19b2
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	X	132,422,072 - 132,422,167 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	X	132,422,072 - 132,422,167 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	X	134,584,480 - 134,584,575 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	X	138,166,421 - 138,166,516 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	X	135,732,125 - 135,732,220 (-)	NCBI	Rnor_WKY
Rnor_6.0	X	140,117,379 - 140,117,474 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	140,117,379 - 140,117,474 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	X	140,167,226 - 140,167,321 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	X	131,322,287 - 131,322,382 (-)	NCBI		Celera
Cytogenetic Map	X	q36	NCBI

MIR19B2
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	X	134,169,671 - 134,169,766 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	X	134,169,671 - 134,169,766 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	X	133,303,701 - 133,303,796 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	X	133,131,366 - 133,131,461 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	X	133,690,534 - 133,690,629 (-)	NCBI		Celera
Cytogenetic Map	X	q26.2	NCBI
HuRef	X	122,701,740 - 122,701,835 (-)	NCBI		HuRef
CHM1_1	X	133,215,397 - 133,215,492 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	X	132,494,818 - 132,494,913 (-)	NCBI		T2T-CHM13v2.0

Mir19b-2
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	51,830,860 - 51,830,943 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	X	51,830,860 - 51,830,943 (-)	Ensembl		GRCm39 Ensembl
GRCm38	X	52,741,983 - 52,742,066 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	52,741,983 - 52,742,066 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	50,095,160 - 50,095,243 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	X	40,158,203 - 40,158,286 (-)	NCBI		Celera
Cytogenetic Map	X	A5	NCBI

MIR19B-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	X	104,895,962 - 104,896,025 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	X	104,895,962 - 104,896,025 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	X	91,006,321 - 91,006,384 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	X	106,755,718 - 106,755,781 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	X	104,168,894 - 104,168,957 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	X	106,034,839 - 106,034,902 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	X	105,820,105 - 105,820,168 (-)	NCBI		UU_Cfam_GSD_1.0

MIR19B-2
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	X	110,113,855 - 110,113,934 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	X	110,113,855 - 110,113,934 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	X	126,199,650 - 126,199,729 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	10994
Count of gene targets:	6582
Count of transcripts:	7067
Interacting mature miRNAs:	rno-miR-19b-2-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1598837	Memor13	Memory QTL 13	3.2		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	X	41052407	146860749	Rat
1598872	Memor14	Memory QTL 14	4.5		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	X	93956491	138956491	Rat
738025	Stresp3	Stress response QTL 3	4.61	0.0066	stress-related behavior trait (VT:0010451)	defensive burying - approach	X	100567703	150256146	Rat
1598809	Memor15	Memory QTL 15	4.4		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	X	103312877	148312877	Rat
1598856	Memor1	Memory QTL 1	1.9		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	X	103312877	148312877	Rat
738029	Stresp2	Stress response QTL 2	3.4	0.0004	stress-related behavior trait (VT:0010451)	defensive burying - approach	X	112934952	138400867	Rat
10059603	Bw174	Body weight QTL 174	3.4	0.025	body mass (VT:0001259)	body weight (CMO:0000012)	X	113937816	152453651	Rat
634346	Insul4	Insulin level QTL 4	0		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	X	126975089	152453651	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	endocrine system	hemolymphoid system	renal system	reproductive system
High
Medium
Low	6	9	2	4
Below cutoff			2

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031821	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000468	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053702

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	X	132,422,072 - 132,422,167 (-)	Ensembl
Rnor_6.0 Ensembl	X	140,117,379 - 140,117,474 (-)	Ensembl

RefSeq Acc Id:

NR_031821

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	X	132,422,072 - 132,422,167 (-)	NCBI
Rnor_6.0	X	140,117,379 - 140,117,474 (-)	NCBI
Rnor_5.0	X	140,167,226 - 140,167,321 (-)	NCBI
Celera	X	131,322,287 - 131,322,382 (-)	NCBI

Sequence:

show sequence

ACATTGCTACTTACGGTTAGTTTTGCAGATTTGCAGTTCAGCGTATATGTGGATATATGGCTGT
GCAAATCCATGCAAAACTGATTGTGATGATGT

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325599	AgrOrtholog
BioCyc Gene	G2FUF-1019	BioCyc
Ensembl Genes	ENSRNOG00000035579	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053702	ENTREZGENE
miRBase	MI0000848	ENTREZGENE
NCBI Gene	100313999	ENTREZGENE
PhenoGen	Mir19b2	PhenoGen
RNAcentral	URS000013D17D	RNACentral
	URS000075C3EC	RNACentral
	URS000075F060	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir19b2	microRNA 19b-2	Mir19b-2	microRNA mir-19b-2	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir19b-2	microRNA mir-19b-2			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar