Mir22 (microRNA 22) - Rat Genome Database

Name: Mir22
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir22 (microRNA 22) Rattus norvegicus

Analyze

Symbol:

Mir22

Name:

microRNA 22

RGD ID:

2325597

Description:

Predicted to enable mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including negative regulation of cell migration involved in sprouting angiogenesis; negative regulation of necroptotic process; and positive regulation of cellular senescence. Predicted to act upstream of or within several processes, including cellular response to phenylalanine; cellular senescence; and long-term synaptic potentiation. Predicted to be located in extracellular exosome. Orthologous to human MIR22 (microRNA 22); PARTICIPATES IN Huntington's disease pathway; Parkinson's disease pathway; INTERACTS WITH 2,5-hexanedione; 2-acetamidofluorene; 3-chloropropane-1,2-diol.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-22; rno-mir-22

RGD Orthologs

Human

Mouse

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	10	60,307,039 - 60,307,133 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	10	60,307,039 - 60,307,133 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	10	64,953,968 - 64,954,062 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	10	64,459,396 - 64,459,490 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	10	59,921,960 - 59,922,054 (+)	NCBI	Rnor_WKY
Rnor_6.0	10	62,299,592 - 62,299,686 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	62,299,592 - 62,299,686 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	62,013,642 - 62,013,736 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	59,335,476 - 59,335,570 (+)	NCBI		Celera
Cytogenetic Map	10	q24	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Chemical and Drug Induced Liver Injury (ISO)

colon cancer (ISO)

drug-induced hepatitis (ISO)

fatty liver disease (ISO)

hepatocellular carcinoma (ISO)

Huntington's disease (ISO)

Inflammation (ISO)

non-alcoholic fatty liver disease (ISO)

pancreatitis (ISO)

Parkinson's disease (ISO)

primary cutaneous T-cell non-Hodgkin lymphoma (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,2-dichloroethane (ISO)

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (ISO)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2,5-hexanedione (EXP)

2-acetamidofluorene (EXP)

3-chloropropane-1,2-diol (EXP)

acetamide (EXP)

actinomycin D (ISO)

aflatoxin B1 (EXP)

all-trans-retinoic acid (ISO)

azoxystrobin (EXP)

Benzo[k]fluoranthene (ISO)

biphenyl-4-amine (ISO)

bis(2-chloroethyl) sulfide (ISO)

bleomycin A2 (EXP)

buta-1,3-diene (ISO)

cadmium atom (EXP)

cadmium dichloride (EXP)

calcitriol (ISO)

chlorpyrifos (EXP)

choline (ISO)

cisplatin (EXP,ISO)

curcumin (ISO)

dehydroepiandrosterone (ISO)

dioxygen (EXP)

endosulfan (ISO)

ethyl methanesulfonate (ISO)

fenhexamid (ISO)

fludioxonil (ISO)

fluoranthene (ISO)

folic acid (ISO)

furan (EXP)

glyphosate (EXP)

imidacloprid (EXP)

L-methionine (ISO)

methapyrilene (EXP)

methotrexate (ISO)

N-ethyl-N-nitrosourea (ISO)

N-nitrosodiethylamine (ISO)

N-nitrosodimethylamine (ISO)

nitrofen (EXP)

ozone (ISO)

paracetamol (EXP,ISO)

Pirarubicin (EXP)

prasugrel hydrochloride (EXP)

progesterone (ISO)

quartz (EXP)

resveratrol (EXP)

rifampicin (ISO)

rotenone (ISO)

rutin (EXP)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (ISO)

sodium fluoride (ISO)

tamoxifen (EXP)

testosterone (ISO)

tetrachloromethane (EXP)

tetraphene (ISO)

thiabendazole (EXP)

thioacetamide (EXP)

titanium dioxide (ISO)

triclocarban (ISO)

triclosan (ISO)

urethane (ISO)

vinclozolin (EXP)

wortmannin (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (ISO)

cellular response to phenylalanine (ISO)

cellular senescence (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of endothelial cell proliferation (ISO)

negative regulation of necroptotic process (ISO)

positive regulation of cellular senescence (ISO)

positive regulation of inflammatory response (ISO)

sensory perception of sound (ISO)

Cellular Component

extracellular exosome (ISO)

Molecular Function

mRNA base-pairing translational repressor activity (ISO)

Molecular Pathway Annotations Click to see Annotation Detail View

Huntington's disease pathway (ISO)

Parkinson's disease pathway (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	miR-22 targets YWHAZ to inhibit metastasis of hepatocellular carcinoma and its down-regulation predicts a poor survival.	Chen M, etal., Oncotarget. 2016 Dec 6;7(49):80751-80764. doi: 10.18632/oncotarget.13037.
2.	miR-22 inhibition reduces hepatic steatosis via FGF21 and FGFR1 induction.	Hu Y, etal., JHEP Rep. 2020 Feb 18;2(2):100093. doi: 10.1016/j.jhepr.2020.100093. eCollection 2020 Apr.
3.	miR-22 promotes HBV-related hepatocellular carcinoma development in males.	Jiang R, etal., Clin Cancer Res. 2011 Sep 1;17(17):5593-603. doi: 10.1158/1078-0432.CCR-10-1734. Epub 2011 Jul 12.
4.	Altered microRNA regulation in Huntington's disease models.	Lee ST, etal., Exp Neurol. 2011 Jan;227(1):172-9. doi: 10.1016/j.expneurol.2010.10.012. Epub 2010 Oct 28.
5.	Identification of blood microRNAs associated to Parkinsonis disease.	Margis R, etal., J Biotechnol. 2011 Mar 20;152(3):96-101. doi: 10.1016/j.jbiotec.2011.01.023. Epub 2011 Feb 3.
6.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
7.	MVP-mediated exosomal sorting of miR-193a promotes colon cancer progression.	Teng Y, etal., Nat Commun. 2017 Feb 17;8:14448. doi: 10.1038/ncomms14448.
8.	MicroRNA-22 expression in hepatocellular carcinoma and its correlation with ezrin protein.	Zhou L, etal., J Int Med Res. 2013 Aug;41(4):1009-16. doi: 10.1177/0300060513484436. Epub 2013 Jun 13.

Additional References at PubMed

PMID:14691248	PMID:16381832	PMID:16766679	PMID:17604727	PMID:17805466	PMID:20403161	PMID:20548288	PMID:21618527	PMID:23524588	PMID:23646144	PMID:23674521	PMID:24338162
PMID:24710937	PMID:25186498	PMID:25751060	PMID:25858512	PMID:26191152	PMID:26512777	PMID:26707060	PMID:26822703	PMID:27174562	PMID:27544030	PMID:27631550	PMID:27878231
PMID:27997889	PMID:29288528	PMID:29486470	PMID:29850604	PMID:30130540	PMID:30568389	PMID:30672441	PMID:30846680	PMID:31115561	PMID:31573048	PMID:31663116	PMID:31719576
PMID:32329883	PMID:32406529	PMID:32631202	PMID:32633388	PMID:32827683	PMID:32864822	PMID:33794525	PMID:33950267	PMID:35833537	PMID:35960478

Genomics

Comparative Map Data

Mir22
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	10	60,307,039 - 60,307,133 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	10	60,307,039 - 60,307,133 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	10	64,953,968 - 64,954,062 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	10	64,459,396 - 64,459,490 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	10	59,921,960 - 59,922,054 (+)	NCBI	Rnor_WKY
Rnor_6.0	10	62,299,592 - 62,299,686 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	62,299,592 - 62,299,686 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	62,013,642 - 62,013,736 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	59,335,476 - 59,335,570 (+)	NCBI		Celera
Cytogenetic Map	10	q24	NCBI

MIR22
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	1,713,903 - 1,713,987 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	17	1,713,903 - 1,713,987 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	17	1,617,197 - 1,617,281 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	1,563,946 - 1,564,030 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	17	1,632,905 - 1,632,989 (-)	NCBI		Celera
Cytogenetic Map	17	p13.3	NCBI
HuRef	17	1,516,889 - 1,516,973 (-)	NCBI		HuRef
CHM1_1	17	1,626,968 - 1,627,052 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	17	1,602,832 - 1,602,916 (-)	NCBI		T2T-CHM13v2.0

Mir22
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	75,354,542 - 75,354,636 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	11	75,354,542 - 75,354,636 (+)	Ensembl		GRCm39 Ensembl
GRCm38	11	75,463,716 - 75,463,810 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	75,463,716 - 75,463,810 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	75,277,218 - 75,277,312 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	11	82,972,112 - 82,972,206 (+)	NCBI		Celera
Cytogenetic Map	11	B5	NCBI

MIR22
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	45,852,534 - 45,852,593 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	9	45,852,517 - 45,852,609 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	9	45,003,215 - 45,003,274 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	9	46,679,619 - 46,679,678 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	9	46,679,602 - 46,679,694 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	9	45,449,590 - 45,449,649 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	9	45,743,952 - 45,744,011 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	9	45,798,566 - 45,798,625 (-)	NCBI		UU_Cfam_GSD_1.0

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	14323
Count of gene targets:	8281
Count of transcripts:	8979
Interacting mature miRNAs:	rno-miR-22-3p, rno-miR-22-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat
631554	Bp133	Blood pressure QTL 133		0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	743364	63851208	Rat
2298544	Neuinf9	Neuroinflammation QTL 9	4.6		nervous system integrity trait (VT:0010566)	spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)	10	5801990	62146030	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6154182	73453136	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6357896	96121100	Rat
2303118	Mamtr7	Mammary tumor resistance QTL 7		0.003	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	9658275	104670812	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14487011	89062041	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14487011	104060283	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14487011	107057807	Rat
1354587	Kidm21	Kidney mass QTL 21	3.3		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	10	15028513	60430477	Rat
6893350	Bw99	Body weight QTL 99	0.87	0.16	body mass (VT:0001259)	body weight (CMO:0000012)	1	15906665	60906665	Rat
6893352	Bw100	Body weight QTL 100	0.33	0.6	body mass (VT:0001259)	body weight (CMO:0000012)	1	15906665	60906665	Rat
1598852	Anxrr19	Anxiety related response QTL 19	5.07		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	10	18167841	63167841	Rat
2313055	Bw96	Body weight QTL 96	3.6	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	10	19606483	64606483	Rat
2313087	Bmd80	Bone mineral density QTL 80	3.2	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	10	19606483	64606483	Rat
1554317	Bmd4	Bone mineral density QTL 4	9.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	19816042	99406971	Rat
1581497	Esta1	Estrogen-induced thymic atrophy QTL 1			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	10	21329805	61345413	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22427500	90627625	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
70224	Eae3	Experimental allergic encephalomyelitis QTL 3	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	10	26521957	61345413	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	26521957	98003205	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	26521957	98952741	Rat
2300171	Bmd58	Bone mineral density QTL 58	4.9	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	26944628	71944628	Rat
10402859	Bp381	Blood pressure QTL 381		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
2292441	Bp308	Blood pressure QTL 308			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	28453136	73453136	Rat
1331762	Rf40	Renal function QTL 40	3.873		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	10	29299504	64155584	Rat
1331791	Cm31	Cardiac mass QTL 31	3.84606		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	29299504	107211142	Rat
631557	Bp136	Blood pressure QTL 136		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	30632053	75632053	Rat
1576311	Pia26	Pristane induced arthritis QTL 26			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	31224026	75632053	Rat
1578779	Tcas10	Tongue tumor susceptibility QTL 10	3.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	10	31297439	76297439	Rat
1576319	Cia29	Collagen induced arthritis QTL 29			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	33973921	78973921	Rat
1358897	Stresp6	Stress response QTL 6	4.17	0.022	blood norepinephrine amount (VT:0005663)	plasma norepinephrine level (CMO:0001010)	10	35392267	64155584	Rat
61441	Btemp1	Thermal response to stress QTL 1	4		body temperature trait (VT:0005535)	core body temperature (CMO:0001036)	10	35392457	63642539	Rat
2317042	Aia20	Adjuvant induced arthritis QTL 20	3.38		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	37565079	82565079	Rat
2317043	Aia7	Adjuvant induced arthritis QTL 7	3.82		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	37565079	82565079	Rat
1576308	Schws1	Schwannoma susceptibility QTL 1		0.0041	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	40035094	102359817	Rat
631269	Cia22	Collagen induced arthritis QTL 22	8.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631270	Cia23	Collagen induced arthritis QTL 23	3.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
631552	Vetf2	Vascular elastic tissue fragility QTL 2	4.5	0.0002	aorta elastic tissue integrity trait (VT:0010556)	artery internal elastic lamina non-tumorous lesion count (CMO:0001913)	10	41142633	86142633	Rat
61463	Bp12	Blood pressure QTL 12	6.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	41333258	86333258	Rat
8552805	Bw145	Body weight QTL 145	2.2		body mass (VT:0001259)	change in body weight to body weight ratio (CMO:0002216)	10	41944526	78307017	Rat
1298078	Stresp5	Stress response QTL 5	2.99	0.00025	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	42045676	104670812	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	42323132	87323132	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	42323132	87323132	Rat
70198	BpQTLcluster9	Blood pressure QTL cluster 9	2.94		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	42323132	87323132	Rat
6893342	Cm78	Cardiac mass QTL 78	0.1	0.88	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	42876766	79813922	Rat
9589030	Epfw9	Epididymal fat weight QTL 9	19.24	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	10	44441699	89441699	Rat
7411614	Foco18	Food consumption QTL 18		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	44441699	89441699	Rat
8694173	Bw149	Body weight QTL 149	4.38	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	10	44441699	89441699	Rat
2300218	Hpcl2	Hepatic cholesterol level QTL 2			liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	45029650	95600334	Rat
631547	Bp87	Blood pressure QTL 87	4.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	47369470	92369470	Rat
2293705	Bmd25	Bone mineral density QTL 25	7.1	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	10	49444551	81709989	Rat
7207811	Bmd90	Bone mineral density QTL 90	5.2		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	10	49444551	81709989	Rat
2293652	Bmd22	Bone mineral density QTL 22	4.9	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
2293669	Bmd33	Bone mineral density QTL 33	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck polar moment of inertia (CMO:0001670)	10	49444551	81709989	Rat
2293679	Bmd30	Bone mineral density QTL 30	3.5	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
1549846	Scl47	Serum cholesterol level QTL 47	3.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	50574707	95574707	Rat
70364	Bp72	Blood pressure QTL 72			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	51121100	96121100	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	51770177	107211142	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	10	51770177	107211142	Rat
1359017	Hrtrt21	Heart rate QTL 21	2.4		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	10	51772940	96772940	Rat
631530	Tls3	T-lymphoma susceptibility QTL 3	0	0.0001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	10	51774612	95600334	Rat
631535	Cm51	Cardiac mass QTL 51	3		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	51786282	91669536	Rat
2306787	Ean3	Experimental allergic neuritis QTL 3	3.1		nervous system integrity trait (VT:0010566)	body weight loss (CMO:0001399)	10	53797385	66979128	Rat
70171	Cari1	Carrageenan-induced inflammation QTL 1	4.9	0.0005	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	10	53797385	107211142	Rat
70164	Bw21	Body weight QTL 21	4.36	0.00005	body mass (VT:0001259)	body weight (CMO:0000012)	10	53797494	98952626	Rat
1354608	Cm33	Cardiac mass QTL 33	2.8		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	10	54809292	99809292	Rat
2298495	Eae23	Experimental allergic encephalomyelitis QTL 23	16.93		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis duration (CMO:0001424)	10	55273696	60677262	Rat
2312662	Slep8	Serum leptin concentration QTL 8		0.05	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	10	57134272	102134272	Rat
2312668	Scl65	Serum cholesterol level QTL 65		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	57134272	102134272	Rat
2312672	Insul15	Insulin level QTL 15		0.01	blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	10	57134272	102134272	Rat
1549831	Bss6	Bone structure and strength QTL 6	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	10	57576521	102576521	Rat
2293698	Bss43	Bone structure and strength QTL 43	5.33	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	10	59209888	104209888	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium	2	22	27	19	5	19	8	10	41	23	9	11	8
Low	1	21	28	20	14	20		1	31	10	31
Below cutoff			2	2		2					1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031824	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC120096	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JACYVU010000220	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053743

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	10	60,307,039 - 60,307,133 (+)	Ensembl
Rnor_6.0 Ensembl	10	62,299,592 - 62,299,686 (+)	Ensembl

RefSeq Acc Id:

NR_031824

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	10	60,307,039 - 60,307,133 (+)	NCBI
Rnor_6.0	10	62,299,592 - 62,299,686 (+)	NCBI
Rnor_5.0	10	62,013,642 - 62,013,736 (+)	NCBI
Celera	10	59,335,476 - 59,335,570 (+)	NCBI

Sequence:

show sequence

ACCTGGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCTTTATGTCCTGACCCAGCTAAAGCTGCC
AGTTGAAGAACTGTTGCCCTCTGCCACTGGC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325597	AgrOrtholog
BioCyc Gene	G2FUF-24200	BioCyc
Ensembl Genes	ENSRNOG00000035620	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053743	ENTREZGENE
miRBase	MI0000851	ENTREZGENE
NCBI Gene	100314001	ENTREZGENE
PhenoGen	Mir22	PhenoGen
RNAcentral	URS0000096022	RNACentral
	URS0000142DC3	RNACentral
	URS000075E8A2	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir22	microRNA 22	Mir22	microRNA mir-22	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir22	microRNA mir-22			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD

RGD Manual Annotations

Send us a Message

Imported Disease Annotations - CTD

RGD Manual Annotations