Mir122 (microRNA 122) - Rat Genome Database

Name: Mir122
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir122 (microRNA 122) Rattus norvegicus

Analyze

Symbol:

Mir122

Name:

microRNA 122

RGD ID:

2325577

Description:

Predicted to act upstream of or within several processes, including BMP signaling pathway; erythrocyte differentiation; and multicellular organismal-level iron ion homeostasis. Predicted to be located in extracellular exosome. Predicted to be part of RISC complex. Biomarker of pterygium. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR122 (microRNA 122); INTERACTS WITH (-)-epigallocatechin 3-gallate; 1-naphthyl isothiocyanate; aflatoxin B1.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Previously known as:

rno-mir-122

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	18	58,758,703 - 58,758,787 (+)	NCBI	mRatBN7.2	mRatBN7.2
UTH_Rnor_SHR_Utx	18	60,852,801 - 60,852,885 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	18	61,551,154 - 61,551,238 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	18	59,375,977 - 59,376,061 (+)	NCBI	Rnor_WKY
Rnor_6.0	18	60,755,285 - 60,755,369 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	18	59,956,811 - 59,956,895 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	18	56,889,469 - 56,889,553 (+)	NCBI		Celera
Cytogenetic Map	18	q12.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

acute kidney failure (ISO)

Acute Liver Failure (ISO)

alcoholic liver cirrhosis (ISO)

Alcoholic Liver Diseases (ISO)

Chemical and Drug Induced Liver Injury (ISO)

Chronic Hepatitis C (ISO)

Experimental Liver Cirrhosis (ISO)

Experimental Radiation Injuries (ISO)

hepatitis B (ISO)

hepatocellular carcinoma (ISO)

immunodeficiency 12 (ISO)

isolated microphthalmia 3 (ISO)

liver cirrhosis (ISO)

Liver Injury (ISO)

lung cancer (ISO)

malaria (ISO)

Metabolic Syndrome (ISO)

pterygium (IEP)

pulmonary fibrosis (ISO)

Radiation Injuries (ISO)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(+)-catechin (ISO)

(-)-citrinin (ISO)

(-)-epigallocatechin 3-gallate (EXP,ISO)

(RS)-coclaurine (ISO)

(RS)-norcoclaurine (ISO)

(S)-coclaurine (ISO)

1,2-dichloroethane (ISO)

1,3,5-trinitro-1,3,5-triazinane (ISO)

1-naphthyl isothiocyanate (EXP)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

3-hydroxybenzoic acid (ISO)

3-hydroxyphenylacetic acid (ISO)

3-methylcholanthrene (ISO)

5-aza-2'-deoxycytidine (ISO)

aflatoxin B1 (EXP,ISO)

allyl alcohol (EXP)

androstane (ISO)

arsane (ISO)

arsenic atom (ISO)

arsenous acid (ISO)

atrazine (EXP)

azoxystrobin (EXP)

benzene (ISO)

benzo[a]pyrene (ISO)

bifenthrin (ISO)

bisphenol A (EXP,ISO)

cadmium atom (EXP)

cadmium dichloride (EXP)

caffeine (ISO)

carbon nanotube (ISO)

chlorpyrifos (EXP)

choline (ISO)

cisplatin (EXP)

clofibrate (EXP)

crocin-1 (EXP)

diarsenic trioxide (ISO)

diclofenac (EXP,ISO)

Diosbulbin B (ISO)

doxorubicin (EXP)

ethanol (ISO)

folic acid (ISO)

formaldehyde (ISO)

furan (EXP)

gallic acid (EXP,ISO)

gentamycin (EXP)

glyphosate (EXP)

hydrogen peroxide (ISO)

hydroquinone (ISO)

idelalisib (ISO)

imidacloprid (EXP)

L-methionine (ISO)

LY294002 (EXP,ISO)

marinobufagenin (EXP)

methamidophos (ISO)

methapyrilene (EXP,ISO)

monocrotaline (ISO)

N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO)

ochratoxin A (ISO)

oleanolic acid (ISO)

paracetamol (EXP,ISO)

paraquat (ISO)

phenobarbital (EXP,ISO)

procyanidin B2 (EXP,ISO)

progesterone (ISO)

puromycin (EXP)

resveratrol (EXP,ISO)

rotenone (EXP)

sirolimus (EXP)

testosterone (ISO)

tetrachloromethane (EXP,ISO)

thiabendazole (EXP)

toluene (ISO)

tolvaptan (ISO)

vanillic acid (ISO)

yohimbine (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

BMP signaling pathway (ISO)

cellular response to amino acid stimulus (ISO)

erythrocyte differentiation (ISO)

multicellular organismal-level iron ion homeostasis (ISO)

regulation of gene expression (ISO)

response to bacterium (ISO)

Cellular Component

extracellular exosome (ISO)

RISC complex (ISO)

RNAi effector complex (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Hepatitis B virus X protein mediated suppression of miRNA-122 expression enhances hepatoblastoma cell proliferation through cyclin G1-p53 axis.	Bandopadhyay M, etal., Infect Agent Cancer. 2016 Aug 15;11:40. doi: 10.1186/s13027-016-0085-6. eCollection 2016.
2.	Regulation of Apoptosis by miR-122 in Pterygium via Targeting Bcl-w.	Cui YH, etal., Invest Ophthalmol Vis Sci. 2016 Jul 1;57(8):3723-30. doi: 10.1167/iovs.16-19402.
3.	Differential miRNA Expression in the Liver of Balb/c Mice Protected by Vaccination during Crisis of Plasmodium chabaudi Blood-Stage Malaria.	Dkhil MA, etal., Front Microbiol. 2017 Jan 11;7:2155. doi: 10.3389/fmicb.2016.02155. eCollection 2016.
4.	Micro-RNA-122 levels in acute liver failure and chronic hepatitis C.	Dubin PH, etal., J Med Virol. 2014 Sep;86(9):1507-14. doi: 10.1002/jmv.23987. Epub 2014 Jun 4.
5.	MiR-122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells.	Fornari F, etal., Cancer Res. 2009 Jul 15;69(14):5761-7. doi: 10.1158/0008-5472.CAN-08-4797. Epub 2009 Jul 7.
6.	Alcohol facilitates HCV RNA replication via up-regulation of miR-122 expression and inhibition of cyclin G1 in human hepatoma cells.	Hou W, etal., Alcohol Clin Exp Res. 2013 Apr;37(4):599-608. doi: 10.1111/acer.12005. Epub 2012 Nov 5.
7.	MicroRNA sponge blocks the tumor-suppressing functions of microRNA-122 in human hepatoma and osteosarcoma cells.	Ma J, etal., Oncol Rep. 2014 Dec;32(6):2744-52. doi: 10.3892/or.2014.3517. Epub 2014 Sep 25.
8.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
9.	MicroRNA 122, Regulated by GRLH2, Protects Livers of Mice and Patients From Ethanol-Induced Liver Disease.	Satishchandran A, etal., Gastroenterology. 2018 Jan;154(1):238-252.e7. doi: 10.1053/j.gastro.2017.09.022. Epub 2017 Oct 4.
10.	Circulating liver-specific miR-122 as a novel potential biomarker for diagnosis of cholestatic liver injury.	Shifeng H, etal., PLoS One. 2013 Sep 27;8(9):e73133. doi: 10.1371/journal.pone.0073133. eCollection 2013.
11.	Loss of microRNA 122 expression in patients with hepatitis B enhances hepatitis B virus replication through cyclin G(1) -modulated P53 activity.	Wang S, etal., Hepatology. 2012 Mar;55(3):730-41. doi: 10.1002/hep.24809.
12.	Circulating MicroRNA-122 Is Associated With the Risk of New-Onset Metabolic Syndrome and Type 2 Diabetes.	Willeit P, etal., Diabetes. 2017 Feb;66(2):347-357. doi: 10.2337/db16-0731. Epub 2016 Nov 29.
13.	Decreased expression of hepatocyte nuclear factor 4α (Hnf4α)/microRNA-122 (miR-122) axis in hepatitis B virus-associated hepatocellular carcinoma enhances potential oncogenic GALNT10 protein activity.	Wu Q, etal., J Biol Chem. 2015 Jan 9;290(2):1170-85. doi: 10.1074/jbc.M114.601203. Epub 2014 Nov 24.
14.	Oleanolic acid suppresses the proliferation of lung carcinoma cells by miR-122/Cyclin G1/MEF2D axis.	Zhao X, etal., Mol Cell Biochem. 2015 Feb;400(1-2):1-7. doi: 10.1007/s11010-014-2228-7. Epub 2014 Dec 4.

Additional References at PubMed

PMID:16381832	PMID:17604727	PMID:19520079	PMID:20403161	PMID:20548288	PMID:21364282	PMID:23185045	PMID:23922812	PMID:24205035	PMID:25769350	PMID:25954995	PMID:25958847
PMID:26125464	PMID:26130369	PMID:27569279	PMID:27940300	PMID:28751928	PMID:29579170	PMID:30030064	PMID:30318957	PMID:30925002	PMID:31373075	PMID:31468622	PMID:31543343
PMID:31626960	PMID:31630081	PMID:31887421	PMID:32061171	PMID:32315718	PMID:33161100	PMID:33247804	PMID:33428882	PMID:33460628	PMID:33950267	PMID:34002676	PMID:34235595
PMID:34998813	PMID:35133561	PMID:35170385	PMID:35174434	PMID:35563621

Genomics

Comparative Map Data

Mir122
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	18	58,758,703 - 58,758,787 (+)	NCBI	mRatBN7.2	mRatBN7.2
UTH_Rnor_SHR_Utx	18	60,852,801 - 60,852,885 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	18	61,551,154 - 61,551,238 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	18	59,375,977 - 59,376,061 (+)	NCBI	Rnor_WKY
Rnor_6.0	18	60,755,285 - 60,755,369 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	18	59,956,811 - 59,956,895 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	18	56,889,469 - 56,889,553 (+)	NCBI		Celera
Cytogenetic Map	18	q12.1	NCBI

MIR122
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	18	58,451,074 - 58,451,158 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	18	58,451,074 - 58,451,158 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	18	56,118,306 - 56,118,390 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	18	54,269,285 - 54,269,369 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	18	52,834,313 - 52,834,397 (+)	NCBI		Celera
Cytogenetic Map	18	q21.31	NCBI
HuRef	18	52,826,687 - 52,826,771 (+)	NCBI		HuRef
CHM1_1	18	56,113,488 - 56,113,572 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	18	58,651,794 - 58,651,878 (+)	NCBI		T2T-CHM13v2.0

Mir122
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	18	65,381,932 - 65,381,997 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	18	65,381,932 - 65,381,997 (+)	Ensembl		GRCm39 Ensembl
GRCm38	18	65,248,861 - 65,248,926 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	18	65,248,861 - 65,248,926 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	18	65,408,515 - 65,408,580 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	18	66,524,341 - 66,524,406 (+)	NCBI		Celera
Cytogenetic Map	18	E1	NCBI

MIR122
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	17,593,858 - 17,593,915 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	17,593,837 - 17,593,929 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	18,577,763 - 18,577,820 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	17,474,133 - 17,474,190 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	1	17,474,112 - 17,474,204 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	1	17,532,433 - 17,532,490 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	17,430,446 - 17,430,503 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	17,698,572 - 17,698,629 (-)	NCBI		UU_Cfam_GSD_1.0

MIR122
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	1	162,329,767 - 162,329,860 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	1	162,329,776 - 162,329,860 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	1	179,916,336 - 179,916,420 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	15500
Count of gene targets:	7715
Count of transcripts:	8274
Interacting mature miRNAs:	rno-miR-122-3p, rno-miR-122-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2299160	Iddm35	Insulin dependent diabetes mellitus QTL 35	2.79		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	18	4207941	60377792	Rat
2293708	Bss46	Bone structure and strength QTL 46	8.8	0.0001	lumbar vertebra morphology trait (VT:0010494)	lumbar vertebra cortical cross-sectional area (CMO:0001690)	18	11791518	63636873	Rat
1578661	Bss20	Bone structure and strength QTL 20	3.7		femur morphology trait (VT:0000559)	femoral neck cross-sectional area (CMO:0001697)	18	11791518	83218561	Rat
1578667	Bss21	Bone structure and strength QTL 21	3.5		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	18	11791518	83218561	Rat
1358358	Sradr6	Stress Responsive Adrenal Weight QTL 6	2.49		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	18	11944299	59330563	Rat
6903359	Bp355	Blood pressure QTL 355	3.6		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	18	11944544	59796478	Rat
2313082	Bss85	Bone structure and strength QTL 85	0.8	0.0001	long bone metaphysis morphology trait (VT:0000133)	tibia midshaft total cross-sectional area (CMO:0001715)	18	14951337	59951337	Rat
1358193	Emca2	Estrogen-induced mammary cancer QTL 2	1.6		mammary gland integrity trait (VT:0010552)	post-insult time to mammary tumor formation (CMO:0000345)	18	18007599	63571040	Rat
1600373	Mamtr6	Mammary tumor resistance QTL 6			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	18	19278901	83218561	Rat
1331741	Bp232	Blood pressure QTL 232	3.59112		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	18	21372893	83213037	Rat
1331733	Bp233	Blood pressure QTL 233	3.97196		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	24796977	79788953	Rat
2325839	Bp348	Blood pressure QTL 348		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	25570985	70570985	Rat
2293704	Bss35	Bone structure and strength QTL 35	4.59	0.0002	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	18	28964853	73964853	Rat
2300157	Bmd66	Bone mineral density QTL 66	13.1	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	18	28964853	73964853	Rat
2300177	Bmd65	Bone mineral density QTL 65	19.7	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	18	28964853	73964853	Rat
9589816	Gluco68	Glucose level QTL 68	7.25	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	18	29792965	74792965	Rat
8694378	Bw157	Body weight QTL 157	3.59	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	18	29792965	74792965	Rat
9590318	Scort22	Serum corticosterone level QTL 22	7.64	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	18	29792965	74792965	Rat
1331754	Bp230	Blood pressure QTL 230	4.61609		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	29792965	74792965	Rat
738005	Anxrr11	Anxiety related response QTL 11	3.4		exploratory behavior trait (VT:0010471)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	18	30039813	75039813	Rat
61383	Bp47	Blood pressure QTL 47	17.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	18	31271681	60377755	Rat
1331742	Bp228	Blood pressure QTL 228	3.88752		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	31359408	59796643	Rat
1331774	Bp226	Blood pressure QTL 226	4.41065		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	31359408	59796643	Rat
1331776	Bp225	Blood pressure QTL 225	2.829		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	18	31359408	59796643	Rat
1331798	Bp224	Blood pressure QTL 224	3.53873		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	31359408	59796643	Rat
1331727	Bp237	Blood pressure QTL 237	3.053		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	31359408	61698465	Rat
61429	Cia17	Collagen induced arthritis QTL 17	4.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	18	31359408	70263868	Rat
2303120	Mamtr8	Mammary tumor resistance QTL 8		0.001	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	18	31359408	83218561	Rat
6903347	Bp350	Blood pressure QTL 350	4.4		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	31359530	59796478	Rat
631274	Sprol1	Serum protein level QTL 1	5.3		blood total protein amount (VT:0005567)	serum total protein level (CMO:0000661)	18	31393320	77209694	Rat
631518	Bw11	Body weight QTL 11	2.8		body mass (VT:0001259)	body weight (CMO:0000012)	18	35870723	80870723	Rat
61367	Iddm4	Insulin dependent diabetes mellitus QTL 4	2.33	0.0074	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	18	38192455	83192455	Rat
1598826	Anxrr20	Anxiety related response QTL 20	3.04		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	18	41432971	83828827	Rat
6893683	Bw110	Body weight QTL 110	2.7	0.002	body mass (VT:0001259)	body weight (CMO:0000012)	18	43345022	83828827	Rat
8694366	Abfw8	Abdominal fat weight QTL 8	6.38	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	18	46640675	83828827	Rat
8694432	Bw165	Body weight QTL 165	3.81	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	18	46640675	83828827	Rat
9589041	Epfw12	Epididymal fat weight QTL 12	17.08	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	18	46640675	83828827	Rat
1331736	Bp227	Blood pressure QTL 227	2.791		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	18	46718763	59796643	Rat
1331780	Bp238	Blood pressure QTL 238	3.269		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	46718763	59796643	Rat
6903345	Bp349	Blood pressure QTL 349	3.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	46718935	59796478	Rat
6903349	Bp351	Blood pressure QTL 351	3.5		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	46718935	59796478	Rat
6903351	Bp352	Blood pressure QTL 352	3.3		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	46718935	59796478	Rat
61360	Eaey	Experimental allergic encephalomyelitis QTL y	3		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis duration (CMO:0001424)	18	46988939	60377753	Rat
2303571	Bw92	Body weight QTL 92	3		body mass (VT:0001259)	body weight (CMO:0000012)	18	48520044	83828827	Rat
2303584	Gluco55	Glucose level QTL 55	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	18	48520044	83828827	Rat
7411719	Strs5	Sensitivity to stroke QTL 5	9.4		cerebrum integrity trait (VT:0010549)	percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)	18	49999958	65845095	Rat
2293658	Bmd23	Bone mineral density QTL 23	7.3	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	18	51464733	63636873	Rat
738008	Hcar14	Hepatocarcinoma resistance QTL 14	4.3		liver integrity trait (VT:0010547)	liver nonremodeling tumorous lesion number (CMO:0001462)	18	51464733	83218561	Rat
1331730	Scl27	Serum cholesterol level QTL 27	3.826		blood HDL cholesterol amount (VT:0000184)	serum high density lipoprotein cholesterol level (CMO:0000361)	18	52292875	59796643	Rat
1331752	Bw27	Body weight QTL 27	2.963		body mass (VT:0001259)	body weight (CMO:0000012)	18	52292875	65845095	Rat
1359020	Ppulsi2	Prepulse inhibition QTL 2	2.71		prepulse inhibition trait (VT:0003088)	acoustic startle response measurement (CMO:0001519)	18	52292875	73997283	Rat
1600375	Mcs22	Mammary carcinoma susceptibility QTL 22	3.3		mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	18	52539763	63933058	Rat
631509	Sald2	Serum aldosterone level QTL 2	2.9		blood aldosterone amount (VT:0005346)	serum aldosterone level (CMO:0000487)	18	52539763	69140759	Rat
12880368	Bw187	Body weight QTL 187		0.045	body mass (VT:0001259)	body weight (CMO:0000012)	18	52539763	76104388	Rat
12904067	Cm122	Cardiac mass QTL 122		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	18	52539763	76104388	Rat
12904069	Cm123	Cardiac mass QTL 123		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	18	52539763	76104388	Rat
12904070	Cm124	Cardiac mass QTL 124		0.01	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	18	52539763	76104388	Rat
12904071	Am18	Aortic mass QTL 18		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	18	52539763	76104388	Rat
12904073	Kidm71	Kidney mass QTL 71		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	18	52539763	76104388	Rat
2301417	Bp319	Blood pressure QTL 319		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	18	52539763	76104388	Rat
1300125	Rf26	Renal function QTL 26	3.2		urine potassium amount (VT:0010539)	urine potassium excretion rate (CMO:0000761)	18	52539863	65844950	Rat
1298072	Cia26	Collagen induced arthritis QTL 26	3.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	18	54709769	83828827	Rat

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031864	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000301	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_031864

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	18	58,758,703 - 58,758,787 (+)	NCBI
Rnor_6.0	18	60,755,285 - 60,755,369 (+)	NCBI
Rnor_5.0	18	59,956,811 - 59,956,895 (+)	NCBI
Celera	18	56,889,469 - 56,889,553 (+)	NCBI

Sequence:

show sequence

CCTTAGCAGAGCTCTGGAGTGTGACAATGGTGTTTGTGTCCAAAACATCAAACGCCATCATCAC
ACTAAACAGCTACTGCTAGGC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325577	AgrOrtholog
BioCyc Gene	G2FUF-7231	BioCyc
miRBase	MI0000891	ENTREZGENE
NCBI Gene	100314023	ENTREZGENE
PhenoGen	Mir122	PhenoGen
RNAcentral	URS00003380CC	RNACentral
	URS000075CD37	RNACentral
	URS000075D321	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir122	microRNA 122	Mir122	microRNA mir-122	Name updated	61478	APPROVED
2010-06-02	Mir122	microRNA mir-122			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD