Mir204 (microRNA 204) - Rat Genome Database

Name: Mir204
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir204 (microRNA 204) Rattus norvegicus

Analyze

Symbol:

Mir204

Name:

microRNA 204

RGD ID:

2325551

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Involved in negative regulation of osteoblast differentiation and positive regulation of fat cell differentiation. Orthologous to human MIR204 (microRNA 204); INTERACTS WITH 2-acetamidofluorene; amphetamine; bleomycin A2.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

rno-mir-204

RGD Orthologs

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	1	220,316,931 - 220,317,040 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	220,316,931 - 220,317,040 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	228,763,010 - 228,763,119 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	235,693,074 - 235,693,183 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	228,511,121 - 228,511,230 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	240,403,000 - 240,403,109 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	240,403,000 - 240,403,109 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	247,690,190 - 247,690,299 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	1	217,535,257 - 217,535,366 (+)	NCBI		Celera
Cytogenetic Map	1	q51	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

hepatitis B (ISO)

Nerve Degeneration (ISO)

pre-eclampsia (ISO)

pulmonary hypertension (ISO)

RETINAL DYSTROPHY AND IRIS COLOBOMA WITH OR WITHOUT CONGENITAL CATARACT (ISO)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

1,4-dichlorobenzene (ISO)

17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO)

2-acetamidofluorene (EXP)

all-trans-retinoic acid (ISO)

amphetamine (EXP)

benzene (ISO)

bis(2-ethylhexyl) phthalate (ISO)

bleomycin A2 (EXP)

buta-1,3-diene (ISO)

cadmium dichloride (EXP,ISO)

chenodeoxycholic acid (ISO)

chloroform (ISO)

cisplatin (EXP)

ethanol (ISO)

furan (EXP)

lead diacetate (ISO)

lead(0) (EXP)

microcystin-LR (ISO)

N-methyl-4-phenylpyridinium (EXP)

oxaliplatin (ISO)

p-cresol (ISO)

phenol (ISO)

Pirarubicin (EXP)

progesterone (ISO)

quartz (EXP)

resveratrol (EXP)

rifampicin (ISO)

rutin (EXP)

sevoflurane (EXP)

sodium arsenite (ISO)

sodium fluoride (ISO)

Testosterone propionate (EXP)

tetrachloromethane (EXP)

trichloroethene (ISO)

zinc atom (EXP,ISO)

zinc(0) (EXP,ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular hyperosmotic salinity response (ISO)

cellular response to decreased oxygen levels (ISO)

cellular response to leukemia inhibitory factor (ISO)

epithelial structure maintenance (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

myelination (ISO)

negative regulation of blood vessel endothelial cell migration (ISO)

negative regulation of cardiac muscle myoblast proliferation (ISO)

negative regulation of cell migration (ISO)

negative regulation of cell population proliferation (ISO)

negative regulation of cellular response to transforming growth factor beta stimulus (ISO)

negative regulation of epithelial to mesenchymal transition (ISO)

negative regulation of gene expression (ISO)

negative regulation of inflammatory response (ISO)

negative regulation of interleukin-1 beta production (ISO)

negative regulation of interleukin-6 production (ISO)

negative regulation of interleukin-8 production (ISO)

negative regulation of non-canonical NF-kappaB signal transduction (ISO)

negative regulation of osteoblast differentiation (IMP,ISO)

negative regulation of prostaglandin biosynthetic process (ISO)

negative regulation of SMAD protein signal transduction (ISO)

negative regulation of transforming growth factor beta receptor signaling pathway (ISO)

negative regulation of tumor necrosis factor production (ISO)

positive regulation of apoptotic process (ISO)

positive regulation of cardiac muscle cell differentiation (ISO)

positive regulation of epithelial cell differentiation (ISO)

positive regulation of fat cell differentiation (IMP)

response to interleukin-1 (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	OMIM Disease Annotation Pipeline	OMIM Disease Annotation Pipeline
2.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
3.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
4.	Long non-coding RNA TCONS_00041960 enhances osteogenesis and inhibits adipogenesis of rat bone marrow mesenchymal stem cell by targeting miR-204-5p and miR-125a-3p.	Shang G, etal., J Cell Physiol. 2018 Aug;233(8):6041-6051. doi: 10.1002/jcp.26424. Epub 2018 Feb 28.

Additional References at PubMed

PMID:16381832	PMID:17028171	PMID:17604727	PMID:19147652	PMID:20403161	PMID:20439489	PMID:20805985	PMID:21628588	PMID:21631941	PMID:25036738	PMID:25858512	PMID:26323722
PMID:26947618	PMID:29196166	PMID:29286154	PMID:29421577	PMID:31542480	PMID:31746352	PMID:31819204	PMID:32487559	PMID:32500147	PMID:32633335	PMID:33336750	PMID:33671638
PMID:34674723	PMID:34942190	PMID:35067796	PMID:36177783	PMID:36544422	PMID:36660176	PMID:36847717	PMID:37196241

Genomics

Comparative Map Data

Mir204
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	1	220,316,931 - 220,317,040 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	220,316,931 - 220,317,040 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	228,763,010 - 228,763,119 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	235,693,074 - 235,693,183 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	228,511,121 - 228,511,230 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	240,403,000 - 240,403,109 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	240,403,000 - 240,403,109 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	247,690,190 - 247,690,299 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	1	217,535,257 - 217,535,366 (+)	NCBI		Celera
Cytogenetic Map	1	q51	NCBI

MIR204
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	70,809,975 - 70,810,084 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	9	70,809,975 - 70,810,084 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	9	73,424,891 - 73,425,000 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	9	72,614,710 - 72,614,819 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	9	43,997,268 - 43,997,377 (-)	NCBI		Celera
Cytogenetic Map	9	q21.12	NCBI
HuRef	9	43,247,472 - 43,247,581 (-)	NCBI		HuRef
CHM1_1	9	73,571,375 - 73,571,484 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	9	82,958,845 - 82,958,954 (-)	NCBI		T2T-CHM13v2.0

Mir204
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	19	22,727,969 - 22,728,036 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	19	22,727,969 - 22,728,036 (+)	Ensembl		GRCm39 Ensembl
GRCm38	19	22,750,605 - 22,750,672 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	19	22,750,605 - 22,750,672 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	19	22,825,095 - 22,825,162 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	19	23,475,157 - 23,475,224 (+)	NCBI		Celera
Cytogenetic Map	19	B	NCBI
cM Map	19	17.26	NCBI

MIR204
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	86,818,494 - 86,818,553 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	86,818,489 - 86,818,556 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	87,290,407 - 87,290,466 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	87,271,368 - 87,271,427 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	1	87,031,968 - 87,032,027 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	86,737,159 - 86,737,218 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	87,494,369 - 87,494,428 (+)	NCBI		UU_Cfam_GSD_1.0

MIR204
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	1	224,065,494 - 224,065,602 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	1	224,065,494 - 224,065,602 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	1	250,527,017 - 250,527,125 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Tagln	rno-miR-204-5p	Mirtarbase	external_info	Microarray	Functional MTI (Weak)	18258830

Predicted Targets

	Summary Value
Count of predictions:	17150
Count of gene targets:	8543
Count of transcripts:	9250
Interacting mature miRNAs:	rno-miR-204-3p, rno-miR-204-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
737828	Hcas3	Hepatocarcinoma susceptibility QTL 3	4.9		liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	1	144267353	222987745	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
7771612	Cm80	Cardiac mass QTL 80	8.4		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	1	149448574	221264292	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1358886	Bp260	Blood pressure QTL 260	3.67		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	151162766	225824951	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
2292220	Bp306	Blood pressure QTL 306	3.47	0.00087	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	243914901	Rat
738032	Hcas5	Hepatocarcinoma susceptibility QTL 5	3.12		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	176426412	257976495	Rat
1600380	Niddm70	Non-insulin dependent diabetes mellitus QTL 70	3.1	0.0008	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	176550523	221550523	Rat
10059600	Bp378	Blood pressure QTL 378	3.08	0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	176869060	221869060	Rat
1354624	Cm35	Cardiac mass QTL35	5.7		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	177227632	256448636	Rat
1354652	Kidm20	Kidney mass QTL 20	4.3		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	177227632	256448636	Rat
1558658	Bw59	Body weight QTL 59	3.5	0.0003	body mass (VT:0001259)	body weight (CMO:0000012)	1	178784622	223784622	Rat
634321	Hc1	Hypercalciuria QTL 1	2.91		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	178810256	240830002	Rat
1578763	Kidm29	Kidney mass QTL 29	3.3	0.0001	kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	1	179567751	260522016	Rat
737977	Bp160	Blood pressure QTL 160		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	181133855	226133855	Rat
2293083	Iddm25	Insulin dependent diabetes mellitus QTL 25	4.18		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	181829673	224569684	Rat
8655655	Arrd2	Age-related retinal degeneration QTL 2	7.79		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	183970203	243914901	Rat
8655855	Arrd3	Age-related retinal degeneration QTL 3	3.07		lens clarity trait (VT:0001304)	cataract incidence/prevalence measurement (CMO:0001585)	1	183970203	243914901	Rat
631838	Niddm36	Non-insulin dependent diabetes mellitus QTL 36		0.01	insulin secretion trait (VT:0003564)	calculated pancreatic islet insulin release measurement (CMO:0001217)	1	184550676	229550676	Rat
1300145	Rf7	Renal function QTL 7	2.96		urine creatinine amount (VT:0010540)	urine creatinine level (CMO:0000125)	1	185145134	221264292	Rat
2312564	Glom18	Glomerulus QTL 18	2.4	0.003	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	1	185356336	231689108	Rat
1582206	Kidm33	Kidney mass QTL 33	6.9		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	188377360	224054420	Rat
1358898	Bp255	Blood pressure QTL 255	3.6		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	191019702	246062233	Rat
10059590	Kidm44	Kidney mass QTL 44	3.42	0.025	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	191033875	236033875	Rat
1358191	Ept10	Estrogen-induced pituitary tumorigenesis QTL 10	3.8		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	192825253	243914732	Rat
8552891	Epfw5	Epididymal fat weight QTL 5	4.4		epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	1	193113876	238113876	Rat
1600388	Niddm67	Non-insulin dependent diabetes mellitus QTL 67	5.84	0.000004	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
1600395	Niddm69	Non-insulin dependent diabetes mellitus QTL 69	4.14	0.0002	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	195804352	257091168	Rat
1600396	Niddm68	Non-insulin dependent diabetes mellitus QTL 68	4.97	0.0003	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
631658	Cm7	Cardiac mass QTL 7	5.32	0.0001	aorta mass (VT:0002845)	aorta weight (CMO:0000076)	1	196248093	241248093	Rat
1358292	Cm37	Cardiac mass QTL 37	6.2	0.00000081	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	1	196248093	241248093	Rat
1600374	Mcs17	Mammary carcinoma susceptibility QTL 17	3		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	1	197670404	242670404	Rat
1641926	Teswt2	Testicular weight QTL 2	2.82		testis mass (VT:1000644)	both testes wet weight (CMO:0000175)	1	197697768	238755659	Rat
2302375	Bw83	Body weight QTL 83	4.87	0.0002	body mass (VT:0001259)	body weight (CMO:0000012)	1	197697768	242697768	Rat
61376	Bp42	Blood pressure QTL 42	23.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	197814409	242814409	Rat
1298084	Thym4	Thymus enlargement QTL 4	10.68		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	197814409	242814409	Rat
1357335	Bw39	Body weight QTL 39	3.3		body mass (VT:0001259)	body weight (CMO:0000012)	1	197814409	242814409	Rat
1331790	Bp201	Blood pressure QTL 201	3.127		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	198211513	225126682	Rat
634313	Niddm43	Non-insulin dependent diabetes mellitus QTL 43			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	199050459	259647894	Rat
2292218	Kidm35	Kidney mass QTL 35			kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	199368955	224569684	Rat
2293694	Bss38	Bone structure and strength QTL 38	7.05	0.0001	femur strength trait (VT:0010010)	femur stiffness (CMO:0001674)	1	201554356	246554356	Rat
7394701	Uae46	Urinary albumin excretion QTL 46	3.6	0.0056	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	201554356	246554356	Rat
2300175	Bmd40	Bone mineral density QTL 40	15.4	0.0001	femur mineral mass (VT:0010011)	bone mineral density (CMO:0001226)	1	201554356	246554356	Rat
2293655	Bss36	Bone structure and strength QTL 36	10.66	0.0001	femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	1	201554356	246554356	Rat
2293674	Bss39	Bone structure and strength QTL 39	7.1	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	1	201554356	246554356	Rat
10059587	Bw173	Body weight QTL 173	3.23	0.025	body mass (VT:0001259)	body weight (CMO:0000012)	1	202069611	247069611	Rat
1600363	Hc6	Hypercalciuria QTL 6	2.7		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	203995416	244113296	Rat
1600397	Edcs4	Endometrial carcinoma susceptibility QTL 4	2.2		uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	1	206081677	251081677	Rat
61403	Niddm4	Non-insulin dependent diabetes mellitus QTL 4			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	206329708	222745518	Rat
1357399	Bw45	Body weight QTL 45	3.05		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	1	206329708	251329708	Rat
1357404	Bw42	Body weight QTL 42	4.49	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	1	206329708	251329708	Rat
1300168	Bp170	Blood pressure QTL 170	2.76		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	207702246	228581766	Rat
1358916	Kidm22	Kidney mass QTL 22	3.32		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	210702053	240947965	Rat
1358890	Bp259	Blood pressure QTL 259	3.06		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	210702053	260522016	Rat
2292216	Bw80	Body weight QTL 80	3.23	0.0019	body mass (VT:0001259)	body weight (CMO:0000012)	1	213533809	243914901	Rat
724538	Kidm1	Kidney mass QTL 1	3.2		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	213707201	252085212	Rat
734768	Niddm59	Non-insulin dependent diabetes mellitus QTL 59			body mass (VT:0001259)	body weight (CMO:0000012)	1	213843987	258843987	Rat
634340	Hcar5	Hepatocarcinoma resistance QTL 5	8		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	214537555	226660468	Rat
61455	Niddm7	Non-insulin dependent diabetes mellitus QTL 7	5.5		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	214537555	238757011	Rat
70211	Niddm24	Non-insulin dependent diabetes mellitus QTL 24	3.79		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	214647894	259647894	Rat
1549910	Bw54	Body weight QTL 54		0.05	body mass (VT:0001259)	body weight (CMO:0000012)	1	214647894	259647894	Rat
61327	Eae7	Experimental allergic encephalomyelitis QTL 7	5.6		body mass (VT:0001259)	change in body weight (CMO:0002045)	1	216255568	260522016	Rat
2302040	Pia35	Pristane induced arthritis QTL 35	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	216255568	260522016	Rat
5508828	Leukc3	Leukocyte quantity QTL 3			eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	1	218108584	224054420	Rat
1598821	Rf55	Renal function QTL 55	6.3		renal blood flow trait (VT:2000006)	ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)	1	218748008	257976495	Rat
61400	Niddm1	Non-insulin dependent diabetes mellitus QTL 1	11		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	218753689	245907899	Rat
724533	Rf51	Renal function QTL 51	5.3	0.0002	kidney plasma flow trait (VT:0005524)	renal plasma flow (CMO:0001914)	1	218753816	256448513	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	circulatory system	endocrine system	hemolymphoid system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium								1
Low		6	13	3	3	18		5	3	3
Below cutoff	1	1	1	1	1	3	3	1	1	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031919	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000047	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSRNOT00000053595

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	1	220,316,931 - 220,317,040 (+)	Ensembl
Rnor_6.0 Ensembl	1	240,403,000 - 240,403,109 (+)	Ensembl

RefSeq Acc Id:

NR_031919

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	1	220,316,931 - 220,317,040 (+)	NCBI
Rnor_6.0	1	240,403,000 - 240,403,109 (+)	NCBI
Rnor_5.0	1	247,690,190 - 247,690,299 (+)	NCBI
Celera	1	217,535,257 - 217,535,366 (+)	NCBI

Sequence:

show sequence

GGCTACAGCCCTTCTTCATGTGACTCGTGGACTTCCCTTTGTCATCCTATGCCTGAGAATATAT
GAAGGAGGCTGGGAAGGCAAAGGGACGTTCAATTGTCATCACTGGC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325551	AgrOrtholog
BioCyc Gene	G2FUF-56125	BioCyc
Ensembl Genes	ENSRNOG00000035472	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053595	ENTREZGENE
miRBase	MI0000946	ENTREZGENE
NCBI Gene	100314051	ENTREZGENE
PhenoGen	Mir204	PhenoGen
RNAcentral	URS000029D9F1	RNACentral
	URS000075BC8E	RNACentral
	URS000075EDE4	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir204	microRNA 204	Mir204	microRNA mir-204	Name updated	61478	APPROVED
2010-06-02	Mir204	microRNA mir-204			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Imported Disease Annotations - OMIM

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Imported Disease Annotations - OMIM