Mir206 (microRNA 206) - Rat Genome Database

Name: Mir206
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir206 (microRNA 206) Rattus norvegicus

Analyze

Symbol:

Mir206

Name:

microRNA 206

RGD ID:

2325550

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including negative regulation of cell adhesion molecule production; negative regulation of cell migration involved in sprouting angiogenesis; and regulation of gene expression. Predicted to act upstream of or within several processes, including cellular response to estrogen stimulus; cellular response to leukemia inhibitory factor; and sensory perception of sound. Predicted to be located in nucleus. Predicted to be part of RISC complex. Biomarker of alcohol use disorder. Human ortholog(s) of this gene implicated in stomach cancer. Orthologous to human MIR206 (microRNA 206); INTERACTS WITH 2,5-hexanedione; atrazine; cadmium dichloride.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-206; rno-mir-206

RGD Orthologs

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	9	23,094,249 - 23,094,332 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	9	23,094,249 - 23,094,332 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	9	31,591,767 - 31,591,850 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	9	36,712,487 - 36,712,570 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	9	35,027,758 - 35,027,841 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	9	26,791,764 - 26,791,847 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	9	26,791,764 - 26,791,847 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	9	25,648,214 - 25,648,297 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	20,674,100 - 20,674,183 (+)	NCBI		Celera
Cytogenetic Map	9	q13	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

alcohol use disorder (IEP)

amyotrophic lateral sclerosis (ISO)

Breast Neoplasms (ISO)

Disease Progression (ISO)

Experimental Liver Neoplasms (ISO)

Hirschsprung's disease (ISO)

Myocardial Reperfusion Injury (ISO)

stomach cancer (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (ISO)

2,5-hexanedione (EXP)

3-methylcholanthrene (ISO)

6-propyl-2-thiouracil (ISO)

atorvastatin calcium (ISO)

atrazine (EXP)

benzo[a]pyrene (ISO)

bis(2-chloroethyl) sulfide (ISO)

cadmium atom (ISO)

cadmium dichloride (EXP)

carbon atom (ISO)

carbon nanotube (ISO)

ciprofloxacin (ISO)

cisplatin (ISO)

diphenylmethane-4,4'-diisocyanate (ISO)

elemental carbon (ISO)

ethanol (ISO)

gemfibrozil (ISO)

lead diacetate (ISO)

Licochalcone B (ISO)

lovastatin (ISO)

methanol (ISO)

methimazole (ISO)

methylmercury chloride (EXP)

perchlorate (ISO)

perfluorooctane-1-sulfonic acid (EXP)

pioglitazone (ISO)

progesterone (ISO)

quercetin (EXP)

resveratrol (ISO)

S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)

sodium arsenite (ISO)

sodium fluoride (ISO)

tetrachloromethane (ISO)

trichostatin A (ISO)

triclocarban (ISO)

triclosan (ISO)

valproic acid (ISO)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to estrogen stimulus (ISO)

cellular response to leukemia inhibitory factor (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of cell adhesion molecule production (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of gene expression (ISO)

negative regulation of interleukin-6 production (ISO)

negative regulation of lipid biosynthetic process (ISO)

negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (ISO)

positive regulation of amyloid-beta formation (ISO)

positive regulation of cholesterol efflux (ISO)

positive regulation of gene expression (ISO)

positive regulation of interleukin-1 beta production (ISO)

positive regulation of neuroinflammatory response (ISO)

positive regulation of tumor necrosis factor production (ISO)

sensory perception of sound (ISO)

Cellular Component

nucleus (ISO)

RISC complex (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

protein binding (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Differential correlation of serum BDNF and microRNA content in rats with rapid or late onset of heavy alcohol use.	Ehinger Y, etal., Addict Biol. 2020 Mar 5:e12890. doi: 10.1111/adb.12890.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
3.	Prognostic significance of combined microRNA-206 and CyclinD2 in gastric cancer patients after curative surgery: A retrospective cohort study.	Shi H, etal., Biomed Pharmacother. 2015 Apr;71:210-5. doi: 10.1016/j.biopha.2014.12.037. Epub 2015 Jan 9.
4.	miR-206 inhibits gastric cancer proliferation in part by repressing cyclinD2.	Zhang L, etal., Cancer Lett. 2013 May 10;332(1):94-101. doi: 10.1016/j.canlet.2013.01.023. Epub 2013 Jan 21.

Additional References at PubMed

PMID:16381832	PMID:16766679	PMID:17604727	PMID:18791161	PMID:19245789	PMID:20403161	PMID:20439489	PMID:22000014	PMID:23337359	PMID:23628900	PMID:23646144	PMID:24672003
PMID:24839168	PMID:25481410	PMID:26333362	PMID:26691660	PMID:27103465	PMID:27706732	PMID:27907012	PMID:28130187	PMID:28328152	PMID:29207029	PMID:30119135	PMID:30335903
PMID:31148248	PMID:31608712	PMID:31894853	PMID:33204065	PMID:33610591	PMID:35092560	PMID:35781830

Genomics

Comparative Map Data

Mir206
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	9	23,094,249 - 23,094,332 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	9	23,094,249 - 23,094,332 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	9	31,591,767 - 31,591,850 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	9	36,712,487 - 36,712,570 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	9	35,027,758 - 35,027,841 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	9	26,791,764 - 26,791,847 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	9	26,791,764 - 26,791,847 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	9	25,648,214 - 25,648,297 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	20,674,100 - 20,674,183 (+)	NCBI		Celera
Cytogenetic Map	9	q13	NCBI

MIR206
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	6	52,144,349 - 52,144,434 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	6	52,144,349 - 52,144,434 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	6	52,009,147 - 52,009,232 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	6	52,117,105 - 52,117,190 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	6	53,670,284 - 53,670,369 (+)	NCBI		Celera
Cytogenetic Map	6	p12.2	NCBI
HuRef	6	51,840,140 - 51,840,225 (+)	NCBI		HuRef
CHM1_1	6	52,011,355 - 52,011,440 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	6	51,983,057 - 51,983,142 (+)	NCBI		T2T-CHM13v2.0

Mir206
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	1	20,749,234 - 20,749,306 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	1	20,749,234 - 20,749,306 (+)	Ensembl		GRCm39 Ensembl
GRCm38	1	20,679,010 - 20,679,082 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	1	20,679,010 - 20,679,082 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	1	20,669,091 - 20,669,163 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	1	20,553,851 - 20,553,923 (+)	NCBI		Celera
Cytogenetic Map	1	A4	NCBI
cM Map	1	6.41	NCBI

MIR206
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	12	19,805,523 - 19,805,582 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	12	19,805,523 - 19,805,582 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	12	19,701,736 - 19,701,795 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	12	20,304,504 - 20,304,563 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	12	20,304,504 - 20,304,563 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	12	19,809,950 - 19,810,009 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	12	19,912,903 - 19,912,962 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	12	20,050,920 - 20,050,979 (+)	NCBI		UU_Cfam_GSD_1.0

MIR206
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	7	45,976,293 - 45,976,372 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	7	45,976,293 - 45,976,372 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	7	52,426,445 - 52,426,524 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Pax3	rno-miR-206-3p	Mirtarbase	external_info	Luciferase reporter assay	Functional MTI	21730146
Igf1	rno-miR-206-3p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR	Functional MTI	19245789
Tppp	rno-miR-206-3p	Mirtarbase	external_info	Immunoblot//Immunocytochemistry//Luciferase report	Functional MTI	19606501

Predicted Targets

	Summary Value
Count of predictions:	13684
Count of gene targets:	7212
Count of transcripts:	7724
Interacting mature miRNAs:	rno-miR-206-3p, rno-miR-206-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
70226	Eae4	Experimental allergic encephalomyelitis QTL 4			nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	9	1	25661317	Rat
9589055	Scfw5	Subcutaneous fat weight QTL 5	5.55	0.001	subcutaneous adipose mass (VT:1000472)	abdominal subcutaneous fat pad weight (CMO:0002069)	9	1	37999212	Rat
7411592	Foco8	Food consumption QTL 8	7.4	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	1	37999212	Rat
9589158	Gluco65	Glucose level QTL 65	6.82	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	9	1	37999212	Rat
1300124	Cm4	Cardiac mass QTL 4	3.55		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	9	1	40594091	Rat
1298088	Edpm11	Estrogen-dependent pituitary mass QTL 11	2.5		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	9	1	43718459	Rat
1641911	Alcrsp13	Alcohol response QTL 13			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	9	1	43718459	Rat
10054125	Srcrt7	Stress Responsive Cort QTL 7	3.33	0.0011	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	9	1	87073594	Rat
1331757	Cdexp1	CD45RC expression in CD8 T cells QTL 1	4.3		CD8-positive T cell quantity (VT:0008077)	blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)	9	1024537	67509080	Rat
1354650	Despr5	Despair related QTL 5	4.01	0.0017	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	9	1254084	46254084	Rat
2303559	Gluco54	Glucose level QTL 54	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	9	1254084	46254084	Rat
61425	Cia15	Collagen induced arthritis QTL 15	4.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	9	5109826	42921101	Rat
631211	Bw4	Body weight QTL4	5.31		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	9	5109826	50109826	Rat
11353947	Bp392	Blood pressure QTL 392			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	7283252	52283252	Rat
9589133	Insul26	Insulin level QTL 26	17.96	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	9	8952560	53952560	Rat
7411609	Foco16	Food consumption QTL 16	25.6	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	8952560	53952560	Rat
1600365	Mcs20	Mammary carcinoma susceptibility QTL 20	3		mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	9	13533770	42791750	Rat
724543	Cm20	Cardiac mass QTL 20	3.9		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	9	16961398	40594091	Rat
631680	Cm11	Cardiac mass QTL 11	3.1	0.00089	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	9	20430519	65430519	Rat
70186	Niddm26	Non-insulin dependent diabetes mellitus QTL 26	3.87		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	9	22071169	86369743	Rat
631643	Bp120	Blood pressure QTL 120	3	0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	22071200	67071200	Rat
1598823	Memor16	Memory QTL 16	1.9		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	9	22133322	49968732	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	renal system	reproductive system	appendage
High
Medium						1	1			1
Low	2	3	3	1	3	7	8	1		7
Below cutoff								1	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031921	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000213	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSRNOT00000053621

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	9	23,094,249 - 23,094,332 (+)	Ensembl
Rnor_6.0 Ensembl	9	26,791,764 - 26,791,847 (+)	Ensembl

RefSeq Acc Id:

NR_031921

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	9	23,094,249 - 23,094,332 (+)	NCBI
Rnor_6.0	9	26,791,764 - 26,791,847 (+)	NCBI
Rnor_5.0	9	25,648,214 - 25,648,297 (+)	NCBI
Celera	9	20,674,100 - 20,674,183 (+)	NCBI

Sequence:

show sequence

CTTCCCCAGGCCACATGCTTCTTTATATCCTCATAGATATCACTGCGCTATGGAATGTAAGGAA
GTGTGTGGTTTTGGCAAGTG

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325550	AgrOrtholog
BioCyc Gene	G2FUF-28038	BioCyc
Ensembl Genes	ENSRNOG00000035498	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053621	ENTREZGENE
miRBase	MI0000948	ENTREZGENE
NCBI Gene	100314052	ENTREZGENE
PhenoGen	Mir206	PhenoGen
RNAcentral	URS000034B6F5	RNACentral
	URS000075A7ED	RNACentral
	URS000075DB46	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir206	microRNA 206	Mir206	microRNA mir-206	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir206	microRNA mir-206			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD