Mir874 (microRNA 874) - Rat Genome Database

Name: Mir874
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir874 (microRNA 874) Rattus norvegicus

Analyze

Symbol:

Mir874

Name:

microRNA 874

RGD ID:

2325511

Description:

Predicted to enable mRNA 3'-UTR binding activity. Predicted to act upstream of or within several processes, including cellular response to oxygen-glucose deprivation; establishment of endothelial intestinal barrier; and miRNA-mediated gene silencing. Orthologous to human MIR874 (microRNA 874); INTERACTS WITH atrazine; cadmium atom; cadmium dichloride.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

rno-mir-874

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	17	6,620,649 - 6,620,724 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	17	6,620,649 - 6,620,724 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	17	6,643,356 - 6,643,431 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	17	8,174,551 - 8,174,626 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	17	6,639,744 - 6,639,819 (+)	NCBI	Rnor_WKY
Rnor_6.0	17	7,025,014 - 7,025,089 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	17	7,025,014 - 7,025,089 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	17	9,222,188 - 9,222,263 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	17	6,727,576 - 6,727,651 (+)	NCBI		Celera
Cytogenetic Map	17	p14	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Neoplasm Invasiveness (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

atrazine (EXP)

benzene (ISO)

benzo[a]pyrene (ISO)

biphenyl-4-amine (ISO)

cadmium atom (EXP)

cadmium dichloride (EXP)

Licochalcone B (ISO)

paclitaxel (ISO)

radon atom (ISO)

radon(0) (ISO)

rifampicin (ISO)

sodium arsenite (ISO)

sodium fluoride (ISO)

toluene (ISO)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to oxygen-glucose deprivation (ISO)

establishment of endothelial intestinal barrier (ISO)

miRNA-mediated gene silencing (ISO)

negative regulation of gene expression (ISO)

regulation of membrane permeability (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:17604727	PMID:20403161	PMID:24462679	PMID:30342851	PMID:31200256	PMID:32805255	PMID:33913264

Genomics

Comparative Map Data

Mir874
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	17	6,620,649 - 6,620,724 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	17	6,620,649 - 6,620,724 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	17	6,643,356 - 6,643,431 (+)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	17	8,174,551 - 8,174,626 (+)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	17	6,639,744 - 6,639,819 (+)	NCBI	Rnor_WKY
Rnor_6.0	17	7,025,014 - 7,025,089 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	17	7,025,014 - 7,025,089 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	17	9,222,188 - 9,222,263 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	17	6,727,576 - 6,727,651 (+)	NCBI		Celera
Cytogenetic Map	17	p14	NCBI

MIR874
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	5	137,647,572 - 137,647,649 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	5	137,647,572 - 137,647,649 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	5	136,983,261 - 136,983,338 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	5	137,011,159 - 137,011,236 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	5	133,106,035 - 133,106,112 (-)	NCBI		Celera
Cytogenetic Map	5	q31.2	NCBI
HuRef	5	132,169,849 - 132,169,926 (-)	NCBI		HuRef
CHM1_1	5	136,414,189 - 136,414,266 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	5	138,168,702 - 138,168,779 (-)	NCBI		T2T-CHM13v2.0

Mir874
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	13	58,170,939 - 58,171,014 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	13	58,170,939 - 58,171,014 (-)	Ensembl		GRCm39 Ensembl
GRCm38	13	58,023,125 - 58,023,200 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	13	58,023,125 - 58,023,200 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	13	58,124,486 - 58,124,561 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	13	59,085,444 - 59,085,519 (-)	NCBI		Celera
Cytogenetic Map	13	B1	NCBI

MIR874
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	11	25,355,355 - 25,355,432 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	11	25,355,354 - 25,355,437 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	11	24,112,394 - 24,112,471 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	11	26,199,027 - 26,199,104 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	11	26,199,026 - 26,199,109 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	11	24,906,934 - 24,907,011 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	11	24,730,798 - 24,730,875 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	11	25,392,426 - 25,392,503 (-)	NCBI		UU_Cfam_GSD_1.0

MIR874
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	2	139,660,118 - 139,660,201 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	2	139,660,118 - 139,660,201 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	2	145,381,098 - 145,381,181 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	14682
Count of gene targets:	8515
Count of transcripts:	9379
Interacting mature miRNAs:	rno-miR-874-3p, rno-miR-874-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
9590316	Scort21	Serum corticosterone level QTL 21	4.75	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	17	1	22871563	Rat
10401807	Kidm52	Kidney mass QTL 52			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	17	1	31701463	Rat
70184	BpQTLcluster14	Blood pressure QTL cluster 14	3.38		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	17	1	31990913	Rat
631207	Niddm41	Non-insulin dependent diabetes mellitus QTL 41			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	17	1	37830672	Rat
1354658	Spl8	Serum phospholipid level QTL 8	3.8		blood VLDL phospholipid amount (VT:0010507)	blood very low density lipoprotein phospholipid level (CMO:0001571)	17	1	60781592	Rat
1354581	Bp247	Blood pressure QTL 247	4.5		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	17	1	69599340	Rat
1354662	Rf49	Renal function QTL 49	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	17	1	69599340	Rat
1641902	Colcr7	Colorectal carcinoma resistance QTL 7	3.35	0.0044	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	17	2115149	21881669	Rat
1300123	Bp194	Blood pressure QTL 194	2.82		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	17	2115149	34551001	Rat
631499	Stl1	Serum triglyceride level QTL 1	3.6		blood triglyceride amount (VT:0002644)	blood triglyceride level (CMO:0000118)	17	3271398	27389946	Rat
2324619	Coatc4	Coat color QTL 4		0.001	coat/hair pigmentation trait (VT:0010463)	pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)	17	4299130	21293263	Rat
2324619	Coatc4	Coat color QTL 4		0.001	coat/hair pigmentation trait (VT:0010463)	pigmented dorsal coat/hair area to total dorsal coat/hair area ratio (CMO:0001811)	17	4299130	21293263	Rat
1354613	Kidm14	Kidney mass QTL 14	6.2		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	17	4299130	35837242	Rat
1354596	Bw32	Body weight QTL 32	4.5		body mass (VT:0001259)	body weight (CMO:0000012)	17	4299130	60781592	Rat
1354630	Cm34	Cardiac mass QTL 34	8.7		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	17	4299130	69599340	Rat
1354638	Insul1	Insulin level QTL 1	4.8		blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	17	4299130	69599340	Rat
1354651	Lmblg2	Limb length QTL 2	6		tibia length (VT:0004357)	tibia length (CMO:0000450)	17	4299130	69599340	Rat
2293648	Bmd31	Bone mineral density QTL 31	4.5	0.0001	femur size trait (VT:1000369)	femoral neck cortical cross-sectional area (CMO:0001702)	17	4354487	27028127	Rat
2293664	Bmd28	Bone mineral density QTL 28	5.1	0.0001	femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	17	4354487	27028127	Rat
2303627	Vencon8	Ventilatory control QTL 8		0.001	respiration trait (VT:0001943)	tidal volume (CMO:0000222)	17	4528038	49528038	Rat
10054088	Scort28	Serum corticosterone level QTL 28	2.04	0.0102	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	17	4528038	49528038	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium
Low		3	6	1	7	1	1	1	40	19	13	7	1
Below cutoff	1	3			1					2	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_032257	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000284	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000063053

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	17	6,620,649 - 6,620,724 (+)	Ensembl
Rnor_6.0 Ensembl	17	7,025,014 - 7,025,089 (+)	Ensembl

RefSeq Acc Id:

NR_032257

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	17	6,620,649 - 6,620,724 (+)	NCBI
Rnor_6.0	17	7,025,014 - 7,025,089 (+)	NCBI
Rnor_5.0	17	9,222,188 - 9,222,263 (+)	NCBI
Celera	17	6,727,576 - 6,727,651 (+)	NCBI

Sequence:

show sequence

TTAGCCCTGCGGCCCCACGCACCAGGGTAAGAGAGACTCGCTTCCTGCCCTGGCCCGAGGGACC
GACTGGCTGGGC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325511	AgrOrtholog
BioCyc Gene	G2FUF-10326	BioCyc
Ensembl Genes	ENSRNOG00000041300	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000063053	ENTREZGENE
miRBase	MI0006118	ENTREZGENE
NCBI Gene	100314096	ENTREZGENE
PhenoGen	Mir874	PhenoGen
RNAcentral	URS00005609ED	RNACentral
	URS00006B4494	RNACentral
	URS000075DC61	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir874	microRNA 874	Mir874	microRNA mir-874	Name updated	61478	APPROVED
2010-06-02	Mir874	microRNA mir-874			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD