Mir322 (microRNA 322) - Rat Genome Database

Name: Mir322
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir322 (microRNA 322) Rattus norvegicus

Analyze

Symbol:

Mir322 (Ensembl: Mir322-2)

Name:

microRNA 322 (Ensembl:microRNA mir-322-2)

RGD ID:

2325467

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including negative regulation of cell population proliferation; negative regulation of cellular response to growth factor stimulus; and negative regulation of signal transduction. Predicted to act upstream of or within several processes, including cellular response to forskolin; cellular response to leukemia inhibitory factor; and sensory perception of sound. Predicted to be located in extracellular space and nucleus. Predicted to be part of RISC complex. Orthologous to human MIR424 (microRNA 424); INTERACTS WITH atrazine; bleomycin A2; marinobufagenin.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-322; microRNA mir-322-2; rno-mir-322; rno-mir-322-1

RGD Orthologs

Human

Mouse

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	X	132,806,594 - 132,806,688 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	X	132,806,594 - 132,806,688 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	X	134,966,643 - 134,966,737 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	X	138,549,491 - 138,549,585 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	X	136,115,203 - 136,115,297 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	X	158,148,161 - 158,148,255 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	158,148,161 - 158,148,255 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	X	152,773,468 - 152,773,562 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Cytogenetic Map	X	q36	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Albuminuria (ISO)

amyotrophic lateral sclerosis (ISO)

autistic disorder (ISO)

Disease Progression (ISO)

syndromic X-linked intellectual disability Lubs type (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,2-dichloroethane (ISO)

1,4-dichlorobenzene (ISO)

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

4-hydroxy-TEMPO (ISO)

aldehydo-D-glucose (ISO)

aluminium atom (ISO)

aluminium(0) (ISO)

atrazine (EXP)

baicalein (ISO)

benzo[a]pyrene (ISO)

bleomycin A2 (EXP)

cadmium atom (ISO)

cadmium dichloride (ISO)

cisplatin (ISO)

cyclosporin A (ISO)

D-glucose (ISO)

decabromodiphenyl ether (ISO)

doxorubicin (ISO)

formaldehyde (ISO)

glucose (ISO)

hydrogen peroxide (ISO)

isoprene (ISO)

Licochalcone B (ISO)

marinobufagenin (EXP)

mechlorethamine (EXP)

methapyrilene (EXP)

methimazole (ISO)

nickel atom (EXP)

nickel sulfate (EXP)

nitrofen (EXP)

ozone (ISO)

paracetamol (EXP)

potassium bromate (ISO)

progesterone (ISO)

quartz (EXP)

quercetin (ISO)

resveratrol (ISO)

S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)

sodium arsenite (ISO)

sodium fluoride (EXP,ISO)

streptozocin (ISO)

tamoxifen (EXP)

toluene (ISO)

valproic acid (ISO)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to forskolin (ISO)

cellular response to inorganic substance (ISO)

cellular response to leukemia inhibitory factor (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of angiogenesis (ISO)

negative regulation of blood vessel endothelial cell migration (ISO)

negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of endothelial cell chemotaxis to fibroblast growth factor (ISO)

negative regulation of endothelial cell chemotaxis to vascular endothelial growth factor (ISO)

negative regulation of endothelial cell proliferation (ISO)

negative regulation of ERK1 and ERK2 cascade (ISO)

negative regulation of fibroblast growth factor receptor signaling pathway (ISO)

negative regulation of G0 to G1 transition (ISO)

negative regulation of transforming growth factor beta receptor signaling pathway (ISO)

negative regulation of vascular associated smooth muscle cell proliferation (ISO)

negative regulation of vascular endothelial cell proliferation (ISO)

negative regulation of vascular endothelial growth factor signaling pathway (ISO)

sensory perception of sound (ISO)

Cellular Component

extracellular space (ISO)

nucleus (ISO)

RISC complex (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:14691248	PMID:16381832	PMID:16766679	PMID:17604727	PMID:20403161	PMID:20439489	PMID:21993888	PMID:22863743	PMID:23185045	PMID:23447642	PMID:23646144	PMID:24554769
PMID:28536423	PMID:29016730	PMID:31992823	PMID:33538533	PMID:35184431	PMID:37566526

Genomics

Comparative Map Data

Mir322
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	X	132,806,594 - 132,806,688 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	X	132,806,594 - 132,806,688 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	X	134,966,643 - 134,966,737 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	X	138,549,491 - 138,549,585 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	X	136,115,203 - 136,115,297 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	X	158,148,161 - 158,148,255 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	158,148,161 - 158,148,255 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	X	152,773,468 - 152,773,562 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Cytogenetic Map	X	q36	NCBI

MIR424
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	X	134,546,614 - 134,546,711 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	X	134,546,614 - 134,546,711 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	X	133,680,644 - 133,680,741 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	X	133,508,309 - 133,508,406 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	X	134,067,462 - 134,067,559 (-)	NCBI		Celera
Cytogenetic Map	X	q26.3	NCBI
HuRef	X	123,079,482 - 123,079,579 (-)	NCBI		HuRef
CHM1_1	X	133,592,397 - 133,592,494 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	X	132,871,802 - 132,871,899 (-)	NCBI		T2T-CHM13v2.0

Mir322
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	52,143,132 - 52,143,226 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	X	52,143,132 - 52,143,226 (-)	Ensembl		GRCm39 Ensembl
GRCm38	X	53,054,255 - 53,054,349 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	53,054,255 - 53,054,349 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	50,407,432 - 50,407,526 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	X	40,480,256 - 40,480,350 (-)	NCBI		Celera
Cytogenetic Map	X	A5	NCBI
cM Map	X	29.31	NCBI

MIR424
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	X	105,183,437 - 105,183,493 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	X	105,183,437 - 105,183,493 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	X	91,294,066 - 91,294,122 (-)	NCBI		Dog10K_Boxer_Tasha
UMICH_Zoey_3.1	X	104,456,601 - 104,456,657 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	X	106,322,578 - 106,322,634 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	X	106,114,264 - 106,114,320 (-)	NCBI		UU_Cfam_GSD_1.0

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1598837	Memor13	Memory QTL 13	3.2		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	X	41052407	146860749	Rat
1598872	Memor14	Memory QTL 14	4.5		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	X	93956491	138956491	Rat
738025	Stresp3	Stress response QTL 3	4.61	0.0066	stress-related behavior trait (VT:0010451)	defensive burying - approach	X	100567703	150256146	Rat
1598809	Memor15	Memory QTL 15	4.4		exploratory behavior trait (VT:0010471)	difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)	X	103312877	148312877	Rat
1598856	Memor1	Memory QTL 1	1.9		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	X	103312877	148312877	Rat
738029	Stresp2	Stress response QTL 2	3.4	0.0004	stress-related behavior trait (VT:0010451)	defensive burying - approach	X	112934952	138400867	Rat
10059603	Bw174	Body weight QTL 174	3.4	0.025	body mass (VT:0001259)	body weight (CMO:0000012)	X	113937816	152453651	Rat
634346	Insul4	Insulin level QTL 4	0		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	X	126975089	152453651	Rat

Markers in Region

RH141141

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	X	132,807,646 - 132,807,828 (-)	MAPPER	mRatBN7.2
Rnor_6.0	X	158,147,021 - 158,147,202	NCBI	Rnor6.0
Rnor_5.0	X	152,772,328 - 152,772,509	UniSTS	Rnor5.0
RGSC_v3.4	X	140,001,214 - 140,001,395	UniSTS	RGSC3.4

RH141390

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	X	132,807,218 - 132,807,415 (-)	MAPPER	mRatBN7.2
Rnor_6.0	X	158,147,434 - 158,147,630	NCBI	Rnor6.0
Rnor_6.0	X	158,583,815 - 158,584,011	NCBI	Rnor6.0
Rnor_5.0	X	153,210,458 - 153,210,654	UniSTS	Rnor5.0
Rnor_5.0	X	152,772,741 - 152,772,937	UniSTS	Rnor5.0
RGSC_v3.4	X	140,000,786 - 140,000,982	UniSTS	RGSC3.4

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031768	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000469	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSRNOT00000071878

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0 Ensembl	X	158,148,161 - 158,148,255 (+)	Ensembl

RefSeq Acc Id:

ENSRNOT00000098692

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	X	132,806,594 - 132,806,688 (-)	Ensembl

RefSeq Acc Id:

NR_031768

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	X	132,806,594 - 132,806,688 (-)	NCBI
Rnor_6.0	X	158,148,161 - 158,148,255 (+)	NCBI
Rnor_5.0	X	152,773,468 - 152,773,562 (+)	NCBI

Sequence:

show sequence

CCTCGCTGACTCCGAAGGGATGCAGCAGCAATTCATGTTTTGGAGTATTGCCAAGGTTCAAAAC
ATGAAGCGCTGCAACACCCCTTCGTGGGAAA

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325467	AgrOrtholog
BioCyc Gene	G2FUF-980	BioCyc
Ensembl Genes	ENSRNOG00000046692	Ensembl
	ENSRNOG00000064087	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000098692	ENTREZGENE
miRBase	MI0000589	ENTREZGENE
NCBI Gene	100314144	ENTREZGENE
PhenoGen	Mir322	PhenoGen
RatGTEx	ENSRNOG00000046692	RatGTEx
	ENSRNOG00000064087	RatGTEx
RNAcentral	URS000040C1ED	RNACentral
	URS000075C0CC	RNACentral
	URS000075E030	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2022-06-02	Mir322	microRNA 322	Mir322	microRNA mir-322-2	Data merged from RGD:149736403	737654	PROVISIONAL
2021-08-09	Mir322	microRNA mir-322-2			Symbol and Name status set to provisional	45752	PROVISIONAL
2014-07-29	Mir322	microRNA 322	Mir322	microRNA mir-322	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir322	microRNA mir-322			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD