Mir93 (microRNA 93) - Rat Genome Database

Name: Mir93
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir93 (microRNA 93) Rattus norvegicus

Analyze

Symbol:

Mir93

Name:

microRNA 93

RGD ID:

2325459

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in negative regulation of gene expression and negative regulation of transporter activity. Predicted to act upstream of or within several processes, including cellular response to forskolin; long-term synaptic potentiation; and negative regulation of B cell apoptotic process. Predicted to be located in extracellular space. Biomarker of hepatocellular carcinoma. Orthologous to human MIR93 (microRNA 93); INTERACTS WITH 17beta-estradiol; 2-acetamidofluorene; 2-methoxyethanol.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

rno-mir-93

RGD Orthologs

Human

Mouse

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	12	17,043,135 - 17,043,221 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	12	17,043,135 - 17,043,221 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	12	17,866,516 - 17,866,602 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	12	18,490,260 - 18,490,346 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	12	17,543,666 - 17,543,752 (-)	NCBI	Rnor_WKY
Rnor_6.0	12	19,307,543 - 19,307,629 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	12	19,307,543 - 19,307,629 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	12	21,365,173 - 21,365,259 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	12	18,973,305 - 18,973,391 (-)	NCBI		Celera
Cytogenetic Map	12	q11	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

alcoholic liver cirrhosis (ISO)

Chemical and Drug Induced Liver Injury (ISO)

colorectal cancer (ISO)

Colorectal Neoplasms (ISO)

hepatocellular carcinoma (IEP)

osteosarcoma (ISO)

pleomorphic xanthoastrocytoma (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,2-dichloroethane (ISO)

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (EXP,ISO)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2-acetamidofluorene (EXP)

2-methoxyethanol (EXP)

atrazine (EXP)

benzo[a]pyrene (ISO)

biphenyl-4-amine (ISO)

bis(2-ethylhexyl) phthalate (EXP,ISO)

bisphenol A (ISO)

bleomycin A2 (EXP)

cadmium atom (ISO)

cadmium dichloride (ISO)

carbon atom (ISO)

carbon monoxide (ISO)

cisplatin (EXP)

elemental carbon (ISO)

ethanol (ISO)

formaldehyde (ISO)

furan (EXP)

galaxolide (ISO)

hydrogen peroxide (ISO)

hydroquinone (ISO)

isoprene (ISO)

L-ascorbic acid (EXP,ISO)

marinobufagenin (EXP)

mechlorethamine (EXP)

methapyrilene (EXP)

Monobutylphthalate (EXP)

monocrotaline (ISO)

N-acetylsphingosine (ISO)

nitrofen (EXP)

paracetamol (EXP,ISO)

phenobarbital (EXP)

progesterone (ISO)

resveratrol (EXP,ISO)

streptozocin (ISO)

sulfur dioxide (ISO)

tamoxifen (EXP)

trichloroethene (ISO)

valproic acid (ISO)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

B cell apoptotic process (ISO)

cellular response to forskolin (ISO)

cellular response to inorganic substance (ISO)

in utero embryonic development (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

negative regulation of apoptotic process (ISO)

negative regulation of B cell apoptotic process (ISO)

negative regulation of BMP secretion (ISO)

negative regulation of BMP signaling pathway (ISO)

negative regulation of cell migration (ISO)

negative regulation of cell population proliferation (ISO)

negative regulation of cytokine production involved in inflammatory response (ISO)

negative regulation of gene expression (ISO)

negative regulation of interleukin-8 production (ISO)

negative regulation of osteoblast differentiation (ISO)

negative regulation of protein secretion (ISO)

negative regulation of transporter activity (ISO)

negative regulation of vascular endothelial growth factor production (ISO)

positive regulation of stem cell proliferation (ISO)

regulation of viral genome replication (ISO)

sensory perception of sound (ISO)

Wnt signaling pathway (ISO)

Cellular Component

extracellular space (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	The miR-93 promotes proliferation by directly targeting PDCD4 in hepatocellular carcinoma.	Huang H, etal., Neoplasma. 2017;64(5):770-777. doi: 10.4149/neo_2017_516.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
3.	miR-106b promotes cancer progression in hepatitis B virus-associated hepatocellular carcinoma.	Yen CS, etal., World J Gastroenterol. 2016 Jun 14;22(22):5183-92. doi: 10.3748/wjg.v22.i22.5183.

Additional References at PubMed

PMID:14691248	PMID:15345052	PMID:16381832	PMID:16682203	PMID:17604727	PMID:17613256	PMID:18329372	PMID:20403161	PMID:21216258	PMID:21993888	PMID:23646144	PMID:25858512
PMID:26798048	PMID:28284149	PMID:29157986	PMID:29243790	PMID:29421576	PMID:29551367	PMID:30178854	PMID:30195636	PMID:31754334	PMID:33414426	PMID:34138419	PMID:34313929

Genomics

Comparative Map Data

Mir93
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	12	17,043,135 - 17,043,221 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	12	17,043,135 - 17,043,221 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	12	17,866,516 - 17,866,602 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	12	18,490,260 - 18,490,346 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	12	17,543,666 - 17,543,752 (-)	NCBI	Rnor_WKY
Rnor_6.0	12	19,307,543 - 19,307,629 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	12	19,307,543 - 19,307,629 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	12	21,365,173 - 21,365,259 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	12	18,973,305 - 18,973,391 (-)	NCBI		Celera
Cytogenetic Map	12	q11	NCBI

MIR93
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	7	100,093,768 - 100,093,847 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	7	100,093,768 - 100,093,847 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	7	99,691,391 - 99,691,470 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	7	99,529,326 - 99,529,405 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	7	94,426,050 - 94,426,129 (-)	NCBI		Celera
Cytogenetic Map	7	q22.1	NCBI
HuRef	7	94,327,042 - 94,327,121 (-)	NCBI		HuRef
CHM1_1	7	99,621,548 - 99,621,627 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	7	101,333,614 - 101,333,693 (-)	NCBI		T2T-CHM13v2.0
CRA_TCAGchr7v2	7	99,051,511 - 99,051,590 (-)	NCBI

Mir93
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	5	138,163,785 - 138,163,872 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	5	138,163,785 - 138,163,872 (-)	Ensembl		GRCm39 Ensembl
GRCm38	5	138,165,523 - 138,165,610 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	5	138,165,523 - 138,165,610 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	5	138,606,751 - 138,606,838 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	5	135,144,855 - 135,144,942 (-)	NCBI		Celera
Cytogenetic Map	5	G2	NCBI

MIR93
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	6	9,498,780 - 9,498,840 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
ROS_Cfam_1.0	6	9,435,781 - 9,435,841 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	6	9,285,107 - 9,285,167 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	6	9,265,403 - 9,265,463 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	6	9,445,018 - 9,445,078 (+)	NCBI		UU_Cfam_GSD_1.0

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	11080
Count of gene targets:	6381
Count of transcripts:	6871
Interacting mature miRNAs:	rno-miR-93-3p, rno-miR-93-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2312418	Kidm41	Kidney mass QTL 41	3.7	0.0001	kidney mass (VT:0002707)	single kidney wet weight to body weight ratio (CMO:0000622)	12	1	19611090	Rat
10755457	Coatc14	Coat color QTL 14		0.01759	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	12	1	22591684	Rat
6893681	Bw109	Body weight QTL 109	2.3	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	12	1	23297788	Rat
1581516	Cm56	Cardiac mass QTL 56	4.2	0.05	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	12	1	29333307	Rat
1598855	Bp294	Blood pressure QTL 294	3.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	12	1	34851688	Rat
7411660	Foco28	Food consumption QTL 28	10.9	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	12	1	42110980	Rat
9590086	Insglur6	Insulin/glucose ratio QTL 6	18.97	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	12	1	42110980	Rat
8694179	Bw150	Body weight QTL 150	2.9	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	12	1	42110980	Rat
7411586	Foco5	Food consumption QTL 5	5.4	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	12	1	42110980	Rat
7411595	Foco9	Food consumption QTL 9	4	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	12	1	42110980	Rat
7411545	Bw128	Body weight QTL 128	5.2	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	12	1	42110980	Rat
9590147	Scort7	Serum corticosterone level QTL 7	13.61	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	12	1	42110980	Rat
2303575	Insul14	Insulin level QTL 14	4		blood insulin amount (VT:0001560)	blood insulin level (CMO:0000349)	12	1	42450532	Rat
737979	Pia22	Pristane induced arthritis QTL 22	53.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	12	1	44465750	Rat
634351	Apr5	Acute phase response QTL 5	6.7		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	12	1	44503507	Rat
2302042	Pia38	Pristane induced arthritis QTL 38	3.5	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	12	1	44503507	Rat
634350	Apr4	Acute phase response QTL 4	6		orosomucoid 1 amount (VT:0010541)	plasma orosomucoid 1 level (CMO:0001467)	12	1172005	46172005	Rat
8552918	Pigfal7	Plasma insulin-like growth factor 1 level QTL 7			blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	12	5564495	46669029	Rat
7411547	Bw129	Body weight QTL 129		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	6	5564495	46669029	Rat
7411597	Foco10	Food consumption QTL 10		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	12	5564495	46669029	Rat
7411641	Foco19	Food consumption QTL 19	27.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	12	5564495	46669029	Rat
8552964	Pigfal17	Plasma insulin-like growth factor 1 level QTL 17	3.5		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	12	5564495	46669029	Rat
7411588	Foco6	Food consumption QTL 6		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	12	5564495	46669029	Rat
8552912	Pigfal6	Plasma insulin-like growth factor 1 level QTL 6	5		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	12	5564498	46669029	Rat
10059594	Kidm46	Kidney mass QTL 46	3.79	0.025	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	12	6107579	46669029	Rat
1600391	Edcs2	Endometrial carcinoma susceptibility QTL2	3.5	0.01	uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	12	6833190	17870186	Rat
1302792	Scl21	Serum cholesterol level QTL 21	3.8	0.0011	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	12	7196730	46669029	Rat
2293086	Iddm30	Insulin dependent diabetes mellitus QTL 30	3.82		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	12	8449490	28302290	Rat
61331	Eau2	Experimental allergic uveoretinitis QTL 2		0.0005	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	12	8525423	28064601	Rat
1300157	Rf21	Renal function QTL 21	4.4		renal blood flow trait (VT:2000006)	absolute change in renal blood flow rate (CMO:0001168)	12	9318216	32103380	Rat
1549829	Scl48	Serum cholesterol level QTL 48	5		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	12	9603277	46669029	Rat
2293699	Bss49	Bone structure and strength QTL 49	5.61	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra trabecular cross-sectional area (CMO:0001692)	12	10474137	46669029	Rat
2300186	Bmd59	Bone mineral density QTL 59	7.1	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	12	10474137	46669029	Rat
1331786	Kidm11	Kidney mass QTL 11	3.571		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	12	11073825	24234895	Rat
1331755	Bp219	Blood pressure QTL 219	3.041		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	12	11073825	28064557	Rat
1331761	Bp218	Blood pressure QTL 218	2.973		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	12	11073825	45055165	Rat
61404	Bw120	Body weight QTL 120	5.1		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	12	12351619	46669029	Rat
1641928	Alcrsp5	Alcohol response QTL 5			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	12	12812385	46669029	Rat
2303569	Gluco44	Glucose level QTL 44	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	12	12812385	46669029	Rat
7204484	Bp358	Blood pressure QTL 358		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	12	13008296	19212979	Rat
1549902	Bp269	Blood pressure QTL 269			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	12	13182736	46669029	Rat
1549912	Bp268	Blood pressure QTL 268			arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	10	13182736	46669029	Rat
2302060	Pia37	Pristane induced arthritis QTL 37	6.1	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	12	13198157	46669029	Rat
61416	Pia4	Pristane induced arthritis QTL 4	8.4		joint integrity trait (VT:0010548)	arthritic paw count (CMO:0001460)	12	13635523	30827399	Rat
61421	Cia12	Collagen induced arthritis QTL 12	4.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	12	13635523	35682913	Rat
61443	Btemp2	Thermal response to stress QTL 2	3.3	0.000094	body temperature trait (VT:0005535)	core body temperature (CMO:0001036)	12	15025183	20794014	Rat
631543	Bp83	Blood pressure QTL 83	5.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	12	15550826	38478808	Rat
2293684	Bmd26	Bone mineral density QTL 26	4.4	0.0002	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	12	15872653	32974238	Rat

Markers in Region

AI747533

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	12	17,042,705 - 17,043,542 (+)	MAPPER	mRatBN7.2
Rnor_6.0	12	19,307,114 - 19,307,950	NCBI	Rnor6.0
Rnor_5.0	12	21,364,744 - 21,365,580	UniSTS	Rnor5.0
RGSC_v3.4	12	17,607,744 - 17,608,580	UniSTS	RGSC3.4
Celera	12	18,972,876 - 18,973,712	UniSTS
Cytogenetic Map	12	q11	UniSTS

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium			4		5						2
Low	1	25	23	11	12	11	5	6	60	17	26	9	5
Below cutoff			6	6		6			2	7	3

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031853	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000225	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053608

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	12	17,043,135 - 17,043,221 (-)	Ensembl
Rnor_6.0 Ensembl	12	19,307,543 - 19,307,629 (-)	Ensembl

RefSeq Acc Id:

NR_031853

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	12	17,043,135 - 17,043,221 (-)	NCBI
Rnor_6.0	12	19,307,543 - 19,307,629 (-)	NCBI
Rnor_5.0	12	21,365,173 - 21,365,259 (-)	NCBI
Celera	12	18,973,305 - 18,973,391 (-)	NCBI

Sequence:

show sequence

AGTCATGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGCATTGCCTGACCTACTGCTGAGCTA
GCACTTCCCGAGCCCCCAGGACA

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325459	AgrOrtholog
BioCyc Gene	G2FUF-19812	BioCyc
Ensembl Genes	ENSRNOG00000035485	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053608	ENTREZGENE
miRBase	MI0000880	ENTREZGENE
NCBI Gene	100314154	ENTREZGENE
PhenoGen	Mir93	PhenoGen
RNAcentral	URS0000149452	RNACentral
	URS000075DD98	RNACentral
	URS000075E435	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir93	microRNA 93	Mir93	microRNA mir-93	Name updated	61478	APPROVED
2010-06-02	Mir93	microRNA mir-93			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD