Mir30b (microRNA 30b) - Rat Genome Database

Name: Mir30b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir30b (microRNA 30b) Rattus norvegicus

Analyze

Symbol:

Mir30b

Name:

microRNA 30b

RGD ID:

2325392

Description:

Predicted to enable mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including positive regulation of macromolecule metabolic process; regulation of T cell activation; and regulation of angiogenesis. Predicted to act upstream of or within several processes, including cellular hyperosmotic salinity response; cellular response to lipopolysaccharide; and long-term synaptic potentiation. Predicted to be located in extracellular space. Orthologous to human MIR30B (microRNA 30b); INTERACTS WITH bisphenol A; bleomycin A2; cisplatin.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

rno-mir-30b

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	7	100,132,589 - 100,132,675 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	100,132,589 - 100,132,675 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	7	101,904,807 - 101,904,893 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	7	104,106,484 - 104,106,570 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	7	104,025,792 - 104,025,878 (-)	NCBI	Rnor_WKY
Rnor_6.0	7	109,282,662 - 109,282,747 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	109,282,658 - 109,282,752 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Celera	7	96,643,845 - 96,643,931 (-)	NCBI		Celera
Cytogenetic Map	7	q34	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

adult respiratory distress syndrome (ISO)

atrial fibrillation (ISO)

Cardiomegaly (IEP)

Chemical and Drug Induced Liver Injury (ISO)

colon cancer (ISO)

colorectal cancer (ISO)

congestive heart failure (ISO)

Experimental Liver Neoplasms (ISO)

liver cirrhosis (ISO)

pancreatitis (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(+)-schisandrin B (ISO)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

3-\{1-[3-(dimethylamino)propyl]-1H-indol-3-yl\}-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione (ISO)

benzene (ISO)

benzo[a]pyrene (ISO)

bisphenol A (EXP,ISO)

bleomycin A2 (EXP)

cadmium dichloride (ISO)

cisplatin (EXP)

dibutyl phthalate (EXP)

formaldehyde (ISO)

hydrogen peroxide (ISO)

Licochalcone B (ISO)

mechlorethamine (EXP)

microcystin-LR (ISO)

N-methyl-4-phenylpyridinium (ISO)

paracetamol (ISO)

paraquat (ISO)

sodium arsenite (ISO)

tetrachloromethane (EXP,ISO)

toluene (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular hyperosmotic salinity response (ISO)

cellular response to lipopolysaccharide (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing (ISO)

negative regulation of angiogenesis (ISO)

negative regulation of endothelial cell apoptotic process (ISO)

negative regulation of regulatory T cell differentiation (ISO)

negative regulation of vascular endothelial cell proliferation (ISO)

positive regulation of activated T cell proliferation (ISO)

positive regulation of gene expression (ISO)

positive regulation of protein phosphorylation (ISO)

positive regulation of sprouting angiogenesis (ISO)

positive regulation of transforming growth factor beta receptor signaling pathway (ISO)

regulation of gene expression (ISO)

response to bacterium (ISO)

response to oxygen levels (ISO)

sensory perception of sound (ISO)

Cellular Component

extracellular space (ISO)

Molecular Function

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	MicroRNA-30b functions as a tumour suppressor in human colorectal cancer by targeting KRAS, PIK3CD and BCL2.	Liao WT, etal., J Pathol. 2014 Mar;232(4):415-27. doi: 10.1002/path.4309.
2.	MiR-30-regulated autophagy mediates angiotensin II-induced myocardial hypertrophy.	Pan W, etal., PLoS One. 2013;8(1):e53950. doi: 10.1371/journal.pone.0053950. Epub 2013 Jan 9.
3.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
4.	MVP-mediated exosomal sorting of miR-193a promotes colon cancer progression.	Teng Y, etal., Nat Commun. 2017 Feb 17;8:14448. doi: 10.1038/ncomms14448.

Additional References at PubMed

PMID:14691248	PMID:15345052	PMID:16381832	PMID:16766679	PMID:17028171	PMID:17604727	PMID:18762567	PMID:19188439	PMID:20403161	PMID:20708584	PMID:23646144	PMID:24178239
PMID:24205035	PMID:24898602	PMID:25701595	PMID:25791621	PMID:25858512	PMID:27765894	PMID:28578340	PMID:30701530	PMID:30721562	PMID:31054938	PMID:31814697	PMID:32329883
PMID:32794050	PMID:32976819	PMID:33930933	PMID:35256590	PMID:36282532

Genomics

Comparative Map Data

Mir30b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	7	100,132,589 - 100,132,675 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	100,132,589 - 100,132,675 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	7	101,904,807 - 101,904,893 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	7	104,106,484 - 104,106,570 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	7	104,025,792 - 104,025,878 (-)	NCBI	Rnor_WKY
Rnor_6.0	7	109,282,662 - 109,282,747 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	109,282,658 - 109,282,752 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Celera	7	96,643,845 - 96,643,931 (-)	NCBI		Celera
Cytogenetic Map	7	q34	NCBI

MIR30B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	8	134,800,520 - 134,800,607 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	8	134,800,520 - 134,800,607 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	8	135,812,763 - 135,812,850 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	8	135,881,944 - 135,882,031 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	8	131,985,504 - 131,985,591 (-)	NCBI		Celera
Cytogenetic Map	8	q24.22	NCBI
HuRef	8	131,128,460 - 131,128,547 (-)	NCBI		HuRef
CHM1_1	8	135,854,881 - 135,854,968 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	8	135,918,411 - 135,918,498 (-)	NCBI		T2T-CHM13v2.0

Mir30b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	68,209,264 - 68,209,359 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	15	68,209,264 - 68,209,359 (-)	Ensembl		GRCm39 Ensembl
GRCm38	15	68,337,415 - 68,337,510 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	68,337,415 - 68,337,510 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	15	68,168,977 - 68,169,072 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	15	69,853,459 - 69,853,554 (-)	NCBI		Celera
Cytogenetic Map	15	D2	NCBI

MIR30B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	13	30,906,038 - 30,906,097 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	13	30,906,038 - 30,906,097 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	13	30,881,273 - 30,881,332 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	13	31,271,855 - 31,271,914 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	13	30,991,393 - 30,991,452 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	13	31,090,357 - 31,090,416 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	13	31,440,586 - 31,440,645 (-)	NCBI		UU_Cfam_GSD_1.0

MIR30B
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	4	6,952,794 - 6,952,869 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	4	6,952,794 - 6,952,869 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	4	6,717,643 - 6,717,718 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
634336	Anxrr17	Anxiety related response QTL 17	3.66		locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	7	924703	115097879	Rat
61357	Bp38	Blood pressure QTL 38	1.6	0.052	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	7	41333674	119109060	Rat
1358361	Sradr5	Stress Responsive Adrenal Weight QTL 5	5.55		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	7	43747012	108555253	Rat
1300179	Kidm5	Kidney mass QTL 5	3.51		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	7	43747012	135012528	Rat
1300149	Cm6	Cardiac mass QTL 6	4.09		heart mass (VT:0007028)	heart left ventricle weight to body weight ratio (CMO:0000530)	7	43747099	102228765	Rat
631504	Cm27	Cardiac mass QTL 27	3.45		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	7	44421311	118198041	Rat
1300151	Bp181	Blood pressure QTL 181	3.36		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	7	53612714	103945643	Rat
2317035	Aia16	Adjuvant induced arthritis QTL 16	2.71		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	7	59238038	104238038	Rat
1298528	Bp169	Blood pressure QTL 169		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	7	61074194	106074194	Rat
1559283	Emca4	Estrogen-induced mammary cancer QTL 4	3.7		mammary gland integrity trait (VT:0010552)	percentage of study population developing mammary tumors during a period of time (CMO:0000948)	7	62004452	101773158	Rat
1576303	Ept7	Estrogen-induced pituitary tumorigenesis QTL 7	3.7		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	7	62004452	101773158	Rat
70173	Niddm19	Non-insulin dependent diabetes mellitus QTL 19	4.33	0.00005	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	7	64002457	135012528	Rat
2316947	Rf58	Renal function QTL 58	7.8		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	7	68938720	113886318	Rat
2316952	Pur22	Proteinuria QTL 22	5.2		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	7	68938720	113886318	Rat
2316955	Stl24	Serum triglyceride level QTL 24	7.1		blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	7	68938720	113886318	Rat
631540	Bw9	Body weight QTL 9	4.5		body mass (VT:0001259)	body weight (CMO:0000012)	7	69736226	117455174	Rat
1357338	Stl17	Serum triglyceride level QTL 17	3.23		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	7	69736356	112729554	Rat
634331	Pia17	Pristane induced arthritis QTL 17	4.7		joint integrity trait (VT:0010548)	arthritic paw count (CMO:0001460)	7	73829340	130221005	Rat
7411654	Foco25	Food consumption QTL 25	9.3	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	7	75918751	120918751	Rat
7411607	Foco15	Food consumption QTL 15		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	7	75918751	120918751	Rat
631529	Tls2	T-lymphoma susceptibility QTL 2	0	0.001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	7	80221299	109401111	Rat
1331746	Kidm9	Kidney mass QTL 9	3.934		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	7	80221299	112308525	Rat
1331728	Bp214	Blood pressure QTL 214	2.825		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	80221299	124373579	Rat
1331768	Kidm10	Kidney mass QTL 10	4.62096		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	7	80221299	125221299	Rat
2317052	Aia17	Adjuvant induced arthritis QTL 17	2.13		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	7	81737938	126737938	Rat
634322	Bw12	Body weight QTL 12	0		body mass (VT:0001259)	body weight (CMO:0000012)	7	83153392	128153392	Rat
1358891	Bp265	Blood pressure QTL 265	2.21		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	83591953	134666232	Rat
1358914	Bp266	Blood pressure QTL 266			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	83591953	134666232	Rat
71114	Niddm14	Non-insulin dependent diabetes mellitus QTL 14	4.5		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	7	84257275	129257275	Rat
2298475	Eau6	Experimental allergic uveoretinitis QTL 6		0.0029	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	7	84257275	129257275	Rat
1558655	Swd4	Spike wave discharge measurement QTL 4	3.68	0.0002	brain electrophysiology trait (VT:0010557)	brain spike-and-wave discharge severity grade (CMO:0001988)	7	86983365	131983365	Rat
10450828	Scl79	Serum cholesterol level QTL 79	3.5	0.001	blood HDL cholesterol amount (VT:0000184)	blood low density lipoprotein cholesterol level (CMO:0000053)	7	89867376	101773158	Rat
1549899	Stresp8	Stress response QTL 8	4.37	0.0008	stress-related behavior trait (VT:0010451)	defensive burying duration (CMO:0001961)	7	90482196	135012528	Rat
2299163	Iddm34	Insulin dependent diabetes mellitus QTL 34	2.71		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	7	91281130	135012528	Rat
631687	Hcas1	Hepatocarcinoma susceptibility QTL 1	3.9	0.001	liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	7	91412594	129807172	Rat
61397	Bw17	Body weight QTL 17	6.3		body mass (VT:0001259)	body weight (CMO:0000012)	7	93595647	106839474	Rat
2313102	Bmd79	Bone mineral density QTL 79	2.3	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	7	94811085	116738842	Rat
1357336	Gluco6	Glucose level QTL 6	3.4		blood glucose amount (VT:0000188)	serum glucose level (CMO:0000543)	7	94811326	116294265	Rat
731176	Glom5	Glomerulus QTL 5	2.5	0.0035	kidney glomerulus morphology trait (VT:0005325)	count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)	7	96670164	135012528	Rat
1298525	Cm1	Cardiac mass QTL 1	2.7		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	7	99736187	103146217	Rat

Markers in Region

D7Uwm26

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	7	100,132,762 - 100,133,039 (+)	MAPPER	mRatBN7.2
Rnor_6.0	7	109,282,835 - 109,283,111	NCBI	Rnor6.0
Rnor_5.0	7	109,225,013 - 109,225,289	UniSTS	Rnor5.0
Celera	7	96,644,019 - 96,644,295	UniSTS
Cytogenetic Map	7		RGD

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium											2	6
Low	2	8	25	9	16	9	8	9	9	8	11	3	8
Below cutoff												1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031841	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000185	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000079419

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	100,132,589 - 100,132,675 (-)	Ensembl
Rnor_6.0 Ensembl	7	109,282,658 - 109,282,752 (-)	Ensembl

RefSeq Acc Id:

NR_031841

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	7	100,132,589 - 100,132,675 (-)	NCBI
Rnor_6.0	7	109,282,662 - 109,282,747 (-)	NCBI
Celera	7	96,643,845 - 96,643,931 (-)	NCBI

Sequence:

show sequence

CCGAGTTTCAGTTCATGTAAACATCCTACACTCAGCTGTCATACATGAGTTGGCTGGGATGTGG
ATGTTTACGTCAGCTGTCTTGGA

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325392	AgrOrtholog
BioCyc Gene	G2FUF-33099	BioCyc
Ensembl Genes	ENSRNOG00000053467	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000079419	ENTREZGENE
miRBase	MI0000868	ENTREZGENE
NCBI Gene	100314231	ENTREZGENE
PhenoGen	Mir30b	PhenoGen
RNAcentral	URS00005165DA	RNACentral
	URS00005E5FB5	RNACentral
	URS000075BCFE	RNACentral
	URS0000CCFFD9	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir30b	microRNA 30b	Mir30b	microRNA mir-30b	Name updated	61478	APPROVED
2010-06-02	Mir30b	microRNA mir-30b			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD