Mir130a (microRNA 130a) - Rat Genome Database

Name: Mir130a
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir130a (microRNA 130a) Rattus norvegicus

Analyze

Symbol:

Mir130a

Name:

microRNA 130a

RGD ID:

2325385

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including negative regulation of gene expression; negative regulation of macrophage activation; and positive regulation of cell population proliferation. Predicted to act upstream of or within several processes, including SMAD protein signal transduction; cellular response to forskolin; and hematopoietic stem cell differentiation. Orthologous to human MIR130A (microRNA 130a); INTERACTS WITH aflatoxin B1; azoxystrobin; bleomycin A2.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-130a; rno-mir-130a

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	3	69,822,542 - 69,822,629 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	3	69,822,542 - 69,822,629 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	3	73,204,341 - 73,204,428 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	3	81,803,003 - 81,803,090 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	3	79,561,913 - 79,562,000 (-)	NCBI	Rnor_WKY
Rnor_6.0	3	72,141,037 - 72,141,124 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	3	72,141,037 - 72,141,124 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	3	78,661,697 - 78,661,784 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	3	69,178,061 - 69,178,148 (-)	NCBI		Celera
Cytogenetic Map	3	q24	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Albuminuria (ISO)

autoimmune thrombocytopenic purpura (ISO)

bronchiolo-alveolar adenocarcinoma (ISO)

Chemical and Drug Induced Liver Injury (ISO)

Cocaine-Related Disorders (ISO)

colorectal cancer (ISO)

intellectual disability (ISO)

Neoplasm Metastasis (ISO)

obesity (ISO)

pancreatitis (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

2-hydroxypropanoic acid (ISO)

3-\{1-[3-(dimethylamino)propyl]-1H-indol-3-yl\}-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione (ISO)

3-isobutyl-1-methyl-7H-xanthine (ISO)

3-methylcholanthrene (ISO)

5-chloro-7-iodoquinolin-8-ol (ISO)

aflatoxin B1 (EXP)

azoxystrobin (EXP)

benzo[a]pyrene (ISO)

bleomycin A2 (EXP)

catechol (ISO)

chlorpyrifos (EXP)

choline (ISO)

cisplatin (EXP,ISO)

cocaine (ISO)

decabromodiphenyl ether (ISO)

dexamethasone (EXP,ISO)

folic acid (ISO)

formaldehyde (ISO)

glyphosate (EXP)

hydrogen peroxide (ISO)

hydroquinone (ISO)

imidacloprid (EXP)

L-methionine (ISO)

marinobufagenin (EXP)

nitrofen (EXP)

paracetamol (ISO)

paraquat (ISO)

rac-lactic acid (ISO)

resveratrol (ISO)

sodium fluoride (ISO)

thiabendazole (EXP)

tributyl phosphate (ISO)

zinc atom (EXP)

zinc dichloride (ISO)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (ISO)

cellular response to forskolin (ISO)

cellular response to glucose stimulus (ISO)

cellular response to inorganic substance (ISO)

cellular response to transforming growth factor beta stimulus (ISO)

cellular senescence (ISO)

hematopoietic stem cell differentiation (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

negative regulation of epithelial cell migration (ISO)

negative regulation of epithelial to mesenchymal transition (ISO)

negative regulation of macrophage activation (ISO)

negative regulation of SMAD protein signal transduction (ISO)

negative regulation of tumor necrosis factor production (ISO)

NIK/NF-kappaB signaling (ISO)

positive regulation of angiogenesis (ISO)

positive regulation of gene expression (ISO)

positive regulation of vascular associated smooth muscle cell proliferation (ISO)

positive regulation of vascular endothelial cell proliferation (ISO)

regulation of insulin secretion involved in cellular response to glucose stimulus (ISO)

sensory perception of sound (ISO)

SMAD protein signal transduction (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
2.	Reduced MIR130A is involved in primary immune thrombocytopenia via targeting TGFB1 and IL18.	Zhao H, etal., Br J Haematol. 2014 Sep;166(5):767-73. doi: 10.1111/bjh.12934. Epub 2014 May 7.

Additional References at PubMed

PMID:14691248	PMID:15345052	PMID:16381832	PMID:16766679	PMID:17604727	PMID:20403161	PMID:20417623	PMID:20548288	PMID:20660734	PMID:21753805	PMID:21993888	PMID:23390484
PMID:23646144	PMID:25631713	PMID:25751060	PMID:25858512	PMID:26255201	PMID:27245166	PMID:29070584	PMID:29399759	PMID:30556887	PMID:31210323	PMID:31226635	PMID:31733099
PMID:31843527	PMID:32481647	PMID:32790238	PMID:32990844	PMID:33360969	PMID:34609952	PMID:35503135

Genomics

Comparative Map Data

Mir130a
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	3	69,822,542 - 69,822,629 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	3	69,822,542 - 69,822,629 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	3	73,204,341 - 73,204,428 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	3	81,803,003 - 81,803,090 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	3	79,561,913 - 79,562,000 (-)	NCBI	Rnor_WKY
Rnor_6.0	3	72,141,037 - 72,141,124 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	3	72,141,037 - 72,141,124 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	3	78,661,697 - 78,661,784 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	3	69,178,061 - 69,178,148 (-)	NCBI		Celera
Cytogenetic Map	3	q24	NCBI

MIR130A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	11	57,641,198 - 57,641,286 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	11	57,641,198 - 57,641,286 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	11	57,408,671 - 57,408,759 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	11	57,165,246 - 57,165,334 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	11	54,765,156 - 54,765,244 (+)	NCBI		Celera
Cytogenetic Map	11	q12.1	NCBI
HuRef	11	53,757,429 - 53,757,517 (+)	NCBI		HuRef
CHM1_1	11	57,274,889 - 57,274,977 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	11	57,591,382 - 57,591,470 (+)	NCBI		T2T-CHM13v2.0

Mir130a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	2	84,571,459 - 84,571,522 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	2	84,571,459 - 84,571,522 (-)	Ensembl		GRCm39 Ensembl
GRCm38	2	84,741,115 - 84,741,178 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	2	84,741,115 - 84,741,178 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	2	84,581,272 - 84,581,335 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	2	86,336,310 - 86,336,373 (-)	NCBI		Celera
Cytogenetic Map	2	D	NCBI

MIR130A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	18	38,543,618 - 38,543,679 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	18	38,543,618 - 38,543,681 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	18	38,090,020 - 38,090,081 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	18	39,225,427 - 39,225,488 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	18	38,808,515 - 38,808,576 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	18	38,381,529 - 38,381,590 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	18	39,012,290 - 39,012,351 (-)	NCBI		UU_Cfam_GSD_1.0

MIR130A
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	2	13,296,695 - 13,296,773 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	2	13,296,695 - 13,296,773 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	2	12,929,884 - 12,929,962 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Acvr1	rno-miR-130a-3p	Mirtarbase	external_info	Microarray	Functional MTI (Weak)	18258830

Predicted Targets

	Summary Value
Count of predictions:	10564
Count of gene targets:	6322
Count of transcripts:	6772
Interacting mature miRNAs:	rno-miR-130a-3p, rno-miR-130a-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
70216	Cm14	Cardiac mass QTL 14	2.1		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	3	31172320	163586636	Rat
631200	Cm25	Cardiac mass QTL 25	4.8	0.0001	heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	3	61134348	89115068	Rat
1559282	Emca5	Estrogen-induced mammary cancer QTL 5	3.9		mammary gland integrity trait (VT:0010552)	percentage of study population developing mammary tumors during a period of time (CMO:0000948)	3	43827364	169034231	Rat
2298542	Neuinf11	Neuroinflammation QTL 11	3.9		nervous system integrity trait (VT:0010566)	spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)	3	15005422	76927699	Rat
2302055	Pia30	Pristane induced arthritis QTL 30	3.5	0.001	blood autoantibody amount (VT:0003725)	serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)	3	27936919	72936919	Rat
724523	Tsu1	Thymus enlargement suppressive QTL 1	3.84		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	3	50437504	115638231	Rat
737818	Hcar12	Hepatocarcinoma resistance QTL 12	2.6		liver integrity trait (VT:0010547)	volume of individual liver tumorous lesion (CMO:0001078)	3	29463235	118376539	Rat
1331777	Bw24	Body weight QTL 24	3.503		body mass (VT:0001259)	body weight (CMO:0000012)	3	39454637	89115240	Rat
631647	Bp122	Blood pressure QTL 122	6.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	30684642	75684642	Rat
631665	Bw8	Body weight QTL 8	5.5		body mass (VT:0001259)	body weight (CMO:0000012)	3	50437042	119183768	Rat
1331795	Rf30	Renal function QTL 30	3.708		urine potassium amount (VT:0010539)	urine potassium level (CMO:0000128)	3	39454637	89115240	Rat
1582210	Bw71	Body weight QTL 71	3.3	0.0012	body mass (VT:0001259)	body weight (CMO:0000012)	3	64655305	115665732	Rat
1582218	Bw74	Body weight QTL 74	3.9	0.0021	body mass (VT:0001259)	body weight (CMO:0000012)	3	53184593	115665732	Rat
1582221	Kidm30	Kidney mass QTL 30	3.5	0.0008	kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	3	64655305	115665732	Rat
1582238	Bw68	Body weight QTL 68	3.2	0.0064	body mass (VT:0001259)	body weight (CMO:0000012)	3	53184593	115665732	Rat
1582239	Epfw1	Epididymal fat weight QTL 1	4.5	0.0006	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	3	53184593	115665732	Rat
2303593	Gluco46	Glucose level QTL 46	3		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	3	28468571	73468571	Rat
1581503	Cm58	Cardiac mass QTL 58	2.7	0.05	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	3	43827364	121056321	Rat
731180	Bp152	Blood pressure QTL 152		0.03	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	53781112	91609953	Rat
731180	Bp152	Blood pressure QTL 152		0.03	arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	3	53781112	91609953	Rat
731180	Bp152	Blood pressure QTL 152		0.03	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	53781112	91609953	Rat
738019	Anxrr10	Anxiety related response QTL 10	3.9		exploratory behavior trait (VT:0010471)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	3	38517803	83517803	Rat
1300178	Hrtrt4	Heart rate QTL 4	3.74		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	3	43827364	90905114	Rat
1581568	Rf53	Renal function QTL 53			urine total protein amount (VT:0000032)	urine protein excretion rate to body weight ratio (CMO:0001099)	3	56395968	161299569	Rat
2301400	Cm68	Cardiac mass QTL 68		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	3	31426403	70668733	Rat
1300111	Rf12	Renal function QTL 12	3.78		renal blood flow trait (VT:2000006)	absolute change in renal blood flow rate (CMO:0001168)	3	61017749	121056321	Rat
1358362	Srcrt2	Stress Responsive Cort QTL 2	2.78		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	3	38192233	133483320	Rat
1354590	Despr11	Despair related QTL 11		0.000031	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	3	28468571	73468571	Rat
1354597	Kidm13	Kidney mass QTL 13	2.9		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	3	41874578	104104347	Rat
1354604	Bw36	Body weight QTL 36	2.9		body mass (VT:0001259)	body weight (CMO:0000012)	3	33703347	104104347	Rat
2301970	Bw81	Body weight QTL 81	5.19		body mass (VT:0001259)	body weight (CMO:0000012)	3	41874578	155617519	Rat
2301971	Cm71	Cardiac mass QTL 71	4.63		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	3	41874578	155617519	Rat
1358186	Ept2	Estrogen-induced pituitary tumorigenesis QTL 2	8.3		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	3	47233430	110362260	Rat
2290452	Scl56	Serum cholesterol level QTL 56	2.26		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	3	1	91609953	Rat
2292591	Esta4	Estrogen-induced thymic atrophy QTL 4			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	3	47233211	147415807	Rat
1354589	Bw31	Body weight QTL 31	3.3		body mass (VT:0001259)	body weight (CMO:0000012)	3	33703347	78196190	Rat
1358885	Bp251	Blood pressure QTL 251	3.8		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	14489145	121056321	Rat
1358888	Bp264	Blood pressure QTL 264	4.43		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	14489145	121056321	Rat
1358905	Hrtrt17	Heart rate QTL 17	5.9	0.000014	heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	3	10861912	89878372	Rat
2292613	Ept16	Estrogen-induced pituitary tumorigenesis QTL 16	8.3		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	3	47233430	110362260	Rat
61356	Bp37	Blood pressure QTL 37	3		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	3	30684642	75684642	Rat
61377	Edpm3	Estrogen-dependent pituitary mass QTL 3	7.05	0.038	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	3	53184692	89878207	Rat
61419	Cia11	Collagen induced arthritis QTL 11	5.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	3	30356773	98535386	Rat
9590286	Uminl1	Urine mineral level QTL 1	3.5	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	3	28249687	73249687	Rat
8694196	Abfw2	Abdominal fat weight QTL 2	16.58	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	3	28249687	73249687	Rat
8694386	Bw159	Body weight QTL 159	4.52	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	3	28249687	73249687	Rat
8552950	Pigfal12	Plasma insulin-like growth factor 1 level QTL 12	7.3		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	3	28249687	73249687	Rat
8662816	Vetf4	Vascular elastic tissue fragility QTL 4	4		renal artery integrity trait (VT:0010642)	number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)	3	59242096	157323038	Rat
9590136	Scort3	Serum corticosterone level QTL 3	23.37	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	3	28249687	73249687	Rat
11565451	Bw177	Body weight QTL 177		0.002	body mass (VT:0001259)	body weight (CMO:0000012)	3	31426403	70668733	Rat
11565452	Kidm57	Kidney mass QTL 57		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	3	31426403	70668733	Rat
12879867	Cm95	Cardiac mass QTL 95		0.047	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	3	31426403	70668733	Rat
12879868	Am6	Aortic mass QTL 6		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	3	31426403	70668733	Rat
12879866	Cm94	Cardiac mass QTL 94		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	3	31426403	70668733	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	nervous system	renal system	reproductive system	respiratory system
High
Medium
Low		2	1	3	1	6	3	7	3
Below cutoff	3	1					1		1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031876	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC096003	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JACYVU010000115	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053693

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	3	69,822,542 - 69,822,629 (-)	Ensembl
Rnor_6.0 Ensembl	3	72,141,037 - 72,141,124 (-)	Ensembl

RefSeq Acc Id:

NR_031876

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	3	69,822,542 - 69,822,629 (-)	NCBI
Rnor_6.0	3	72,141,037 - 72,141,124 (-)	NCBI
Rnor_5.0	3	78,661,697 - 78,661,784 (-)	NCBI
Celera	3	69,178,061 - 69,178,148 (-)	NCBI

Sequence:

show sequence

TGCTGCTGGCCGGAGCTCTTTTCACATTGTGCTACTGTCTACACGTGTACCGAGCAGTGCAATG
TTAAAAGGGCATCGGCCTTGTAGT

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325385	AgrOrtholog
BioCyc Gene	G2FUF-49162	BioCyc
Ensembl Genes	ENSRNOG00000035570	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053693	ENTREZGENE
miRBase	MI0000903	ENTREZGENE
NCBI Gene	100314238	ENTREZGENE
PhenoGen	Mir130a	PhenoGen
RNAcentral	URS0000229ECD	RNACentral
	URS0000315338	RNACentral
	URS000075D4CA	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir130a	microRNA 130a	Mir130a	microRNA mir-130a	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir130a	microRNA mir-130a			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD