Mir375 (microRNA 375) - Rat Genome Database

Name: Mir375
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir375 (microRNA 375) Rattus norvegicus

Analyze

Symbol:

Mir375

Name:

microRNA 375

RGD ID:

2325360

Description:

Predicted to be involved in negative regulation of sprouting angiogenesis and positive regulation of endothelial cell apoptotic process. Predicted to act upstream of or within type B pancreatic cell development. Orthologous to human MIR375 (microRNA 375); INTERACTS WITH 2,5-hexanedione; aflatoxin B1; amphetamine.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-375; rno-mir-375

RGD Orthologs

Human

Mouse

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	9	76,457,911 - 76,457,985 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	9	76,457,911 - 76,457,985 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	9	84,902,918 - 84,902,992 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	9	90,031,868 - 90,031,942 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	9	88,418,026 - 88,418,100 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	9	82,161,716 - 82,161,790 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	9	82,161,716 - 82,161,790 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	9	81,930,296 - 81,930,370 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	74,029,377 - 74,029,451 (-)	NCBI		Celera
Cytogenetic Map	9	q33	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

alacrima, achalasia, and impaired intellectual development syndrome (ISO)

Alzheimer's disease (ISO)

bacterial gastritis (ISO)

cerebrotendinous xanthomatosis (ISO)

Myocardial Reperfusion Injury (ISO)

myofibrillar myopathy 1 (ISO)

Neurodevelopmental Disorders (ISO)

pancreatitis (ISO)

paroxysmal nonkinesigenic dyskinesia 1 (ISO)

stomach cancer (ISO)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(-)-alpha-phellandrene (ISO)

2,5-hexanedione (EXP)

aflatoxin B1 (EXP)

alpha-phellandrene (ISO)

amphetamine (EXP)

arsenite(3-) (ISO)

atrazine (EXP)

benzo[a]pyrene (ISO)

bis(2-ethylhexyl) phthalate (EXP)

bisphenol A (EXP)

bleomycin A2 (EXP)

cadmium atom (ISO)

cadmium dichloride (ISO)

chromium(6+) (ISO)

cisplatin (EXP,ISO)

ethanol (ISO)

ethylparaben (ISO)

folic acid (ISO)

furan (EXP)

glyphosate (ISO)

lead diacetate (ISO)

marinobufagenin (EXP)

methamidophos (ISO)

methapyrilene (EXP)

methimazole (ISO)

N-nitrosodiethylamine (ISO)

nitrofen (EXP)

nitrogen dioxide (ISO)

paracetamol (EXP)

quartz (EXP)

radon atom (ISO)

radon(0) (ISO)

resveratrol (EXP,ISO)

S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)

sodium arsenite (ISO)

sporidesmin A (ISO)

streptozocin (EXP)

sulfur dioxide (ISO)

tamoxifen (EXP)

valproic acid (ISO)

zinc atom (EXP,ISO)

zinc(0) (EXP,ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

negative regulation of sprouting angiogenesis (ISO)

positive regulation of endothelial cell apoptotic process (ISO)

type B pancreatic cell development (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	miR-375 inhibits Helicobacter pylori-induced gastric carcinogenesis by blocking JAK2-STAT3 signaling.	Miao L, etal., Cancer Immunol Immunother. 2014 Jul;63(7):699-711. doi: 10.1007/s00262-014-1550-y. Epub 2014 Apr 10.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:17604727	PMID:17804764	PMID:18086561	PMID:20403161	PMID:22539037	PMID:22778717	PMID:23396279	PMID:24548484	PMID:24834976	PMID:25619565	PMID:26631961
PMID:27371368	PMID:27521901	PMID:28254488	PMID:28356269	PMID:29187583	PMID:29322249	PMID:30618075	PMID:32196570	PMID:32644005	PMID:33107061	PMID:33128129	PMID:34036397
PMID:34280452	PMID:34845965	PMID:35498204

Genomics

Comparative Map Data

Mir375
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	9	76,457,911 - 76,457,985 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	9	76,457,911 - 76,457,985 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	9	84,902,918 - 84,902,992 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	9	90,031,868 - 90,031,942 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	9	88,418,026 - 88,418,100 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	9	82,161,716 - 82,161,790 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	9	82,161,716 - 82,161,790 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	9	81,930,296 - 81,930,370 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	74,029,377 - 74,029,451 (-)	NCBI		Celera
Cytogenetic Map	9	q33	NCBI

MIR375
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	2	219,001,645 - 219,001,708 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	2	219,001,645 - 219,001,708 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	2	219,866,367 - 219,866,430 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	2	219,574,610 - 219,574,673 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	2	213,636,080 - 213,636,143 (-)	NCBI		Celera
Cytogenetic Map	2	q35	NCBI
HuRef	2	211,720,395 - 211,720,458 (-)	NCBI		HuRef
CHM1_1	2	219,873,820 - 219,873,883 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	2	219,490,020 - 219,490,083 (-)	NCBI		T2T-CHM13v2.0

Mir375
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	1	74,939,817 - 74,939,880 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	1	74,939,817 - 74,939,880 (-)	Ensembl		GRCm39 Ensembl
GRCm38	1	74,900,658 - 74,900,721 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	1	74,900,658 - 74,900,721 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	1	74,947,232 - 74,947,295 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	1	75,455,688 - 75,455,751 (-)	NCBI		Celera
Cytogenetic Map	1	C4	NCBI
cM Map	1	38.54	NCBI

MIR375
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	37	25,568,052 - 25,568,121 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	37	25,568,052 - 25,568,127 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	37	26,388,246 - 26,388,315 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	37	25,583,487 - 25,583,556 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	37	25,488,066 - 25,488,135 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	37	25,423,157 - 25,423,226 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	37	25,443,921 - 25,443,990 (-)	NCBI		UU_Cfam_GSD_1.0

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Pdk1	rno-miR-375-3p	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	18591395

Predicted Targets

	Summary Value
Count of predictions:	6750
Count of gene targets:	4551
Count of transcripts:	4805
Interacting mature miRNAs:	rno-miR-375-3p, rno-miR-375-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10054125	Srcrt7	Stress Responsive Cort QTL 7	3.33	0.0011	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	9	1	87073594	Rat
70186	Niddm26	Non-insulin dependent diabetes mellitus QTL 26	3.87		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	9	22071169	86369743	Rat
7207814	Bmd91	Bone mineral density QTL 91	3.5		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	9	23754144	83851531	Rat
70218	Cm28	Cardiac mass QTL 28	8.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	9	25268044	79271759	Rat
724544	Uae9	Urinary albumin excretion QTL 9	4.5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	9	25268044	114175309	Rat
731164	Uae25	Urinary albumin excretion QTL 25	3.5	0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	9	25661188	100929786	Rat
7411656	Foco26	Food consumption QTL 26	9.8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	32535505	77535505	Rat
7411571	Bw138	Body weight QTL 138	14.3	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	9	32535505	77535505	Rat
1598834	Memor11	Memory QTL 11	2.5		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	9	36962359	77814038	Rat
8662828	Vetf6	Vascular elastic tissue fragility QTL 6	3.9		artery integrity trait (VT:0010639)	patent ductus arteriosus score (CMO:0002566)	9	36962359	92058970	Rat
2290450	Scl57	Serum cholesterol level QTL 57	4.15		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	9	36962359	95410867	Rat
6903941	Pur31	Proteinuria QTL 31		0.036	urine total protein amount (VT:0000032)	urine protein excretion rate (CMO:0000759)	9	40194188	85194188	Rat
11353949	Bp393	Blood pressure QTL 393			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	40194188	85194188	Rat
61352	Bp34	Blood pressure QTL 34	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	42495343	79271511	Rat
10058949	Gmadr5	Adrenal mass QTL 5	2	0.014	adrenal gland mass (VT:0010420)	both adrenal glands wet weight to body weight ratio (CMO:0002411)	9	42791513	87976209	Rat
11353951	Bp394	Blood pressure QTL 394			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	44649921	89649921	Rat
12879506	Pur33	Proteinuria QTL 33			urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	9	44649921	89649921	Rat
11353957	Bmd92	Bone mineral density QTL 92		0.01	tibia mineral mass (VT:1000283)	volumetric bone mineral density (CMO:0001553)	9	46114199	91114199	Rat
631656	Bp108	Blood pressure QTL 108	5.97	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	48598251	93598251	Rat
2303170	Bp332	Blood pressure QTL 332	3.73	0.027	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	9	55847841	77026453	Rat
2303180	Bp333	Blood pressure QTL 333		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	9	56627713	78595166	Rat
2303180	Bp333	Blood pressure QTL 333		0.001	arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	9	56627713	78595166	Rat
2303180	Bp333	Blood pressure QTL 333		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	56627713	78595166	Rat
1578760	Cm53	Cardiac mass QTL 53	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	9	56771635	101771635	Rat
724515	Uae16	Urinary albumin excretion QTL 16	8		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	9	58163035	100929646	Rat
1300134	Bp185	Blood pressure QTL 185	3.73		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	9	61381434	104821652	Rat
1581580	Uae34	Urinary albumin excretion QTL 34			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	9	62072275	96470995	Rat
1578757	Pur6	Proteinuria QTL 6	3.3	0.005	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	9	62072275	96470995	Rat
61385	Edpm9	Estrogen-dependent pituitary mass QTL 9	3.43	0.05	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	9	63869687	108869687	Rat
731171	Glom6	Glomerulus QTL 6	2.8	0.0003	kidney glomerulus morphology trait (VT:0005325)	count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)	9	64573531	109573531	Rat
1354626	Bvd1	Brain ventricular dilatation QTL 1	3.73	0.001	brain ventricle morphology trait (VT:0000822)	hydrocephalus severity score (CMO:0001881)	9	75712843	111552878	Rat

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	endocrine system	reproductive system
High
Medium
Low	1	1	3
Below cutoff		1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_032271	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC132020	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JACYVU010000215	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSRNOT00000053578

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	9	76,457,911 - 76,457,985 (-)	Ensembl
Rnor_6.0 Ensembl	9	82,161,716 - 82,161,790 (-)	Ensembl

RefSeq Acc Id:

NR_032271

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	9	76,457,911 - 76,457,985 (-)	NCBI
Rnor_6.0	9	82,161,716 - 82,161,790 (-)	NCBI
Rnor_5.0	9	81,930,296 - 81,930,370 (-)	NCBI
Celera	9	74,029,377 - 74,029,451 (-)	NCBI

Sequence:

show sequence

TCCGGCCCCGCGACGAGCCCCTCGCACAAACCGGACCTGAGCGTTTTGTTCGTTCGGCTCGCGT
GAGGCAGGGGC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325360	AgrOrtholog
BioCyc Gene	G2FUF-27108	BioCyc
Ensembl Genes	ENSRNOG00000035455	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053578	ENTREZGENE
miRBase	MI0006140	ENTREZGENE
NCBI Gene	100314263	ENTREZGENE
PhenoGen	Mir375	PhenoGen
RNAcentral	URS00000ED600	RNACentral
	URS000075CCDA	RNACentral
	URS000075DEE4	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir375	microRNA 375	Mir375	microRNA mir-375	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir375	microRNA mir-375			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD