Mir208b (microRNA 208b) - Rat Genome Database

Name: Mir208b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir208b (microRNA 208b) Mus musculus

Analyze

Symbol:

Mir208b

Name:

microRNA 208b

RGD ID:

2314107

MGI Page

MGI

Description:

Enables RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and chromatin binding activity. Involved in chromatin organization. Acts upstream of or within several processes, including cardiac muscle hypertrophy in response to stress; cellular response to trichostatin A; and establishment of protein localization to chromatin. Located in cytosol and nucleus. Is expressed in heart and soleus. Orthologous to human MIR208B (microRNA 208b).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

mir-208b; Mirn2; Mirn208b

RGD Orthologs

Human

Rat

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	14	55,213,157 - 55,213,233 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	14	55,213,157 - 55,213,233 (-)	Ensembl		GRCm39 Ensembl
GRCm38	14	54,975,700 - 54,975,776 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	14	54,975,700 - 54,975,776 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	14	55,594,537 - 55,594,613 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	14	52,781,639 - 52,781,715 (-)	NCBI		Celera
Cytogenetic Map	14	C3	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Brain-Lung-Thyroid Syndrome (ISO)

hypertrophic cardiomyopathy (ISO)

hypertrophic cardiomyopathy 14 (ISO)

lysinuric protein intolerance (ISO)

Specific Granule Deficiency (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

benzo[a]pyrene (ISO)

cadmium atom (ISO)

cadmium dichloride (ISO)

carbon atom (ISO)

elemental carbon (ISO)

ethanol (ISO)

isoprenaline (ISO)

Pirarubicin (ISO)

rutin (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cardiac muscle hypertrophy in response to stress (IDA)

cellular response to trichostatin A (IDA)

chromatin organization (IGI,IMP)

establishment of protein localization to chromatin (IMP)

miRNA-mediated gene silencing (ISO)

muscle cell development (IMP)

negative regulation of calcium ion import across plasma membrane (ISO)

negative regulation of gene expression (IDA)

negative regulation of voltage-gated calcium channel activity (ISO)

regulation of gene expression (IMP)

Cellular Component

cytosol (IDA)

nucleus (IDA)

Molecular Function

chromatin binding (IDA)

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

protein binding (IMP,IPI)

RNA polymerase II cis-regulatory region sequence-specific DNA binding (IDA)

Phenotype Annotations Click to see Annotation Detail View

Mammalian Phenotype

abnormal skeletal muscle fiber type ratio (IAGP)

no abnormal phenotype detected (IAGP)

References

References - curated

#	Reference Title	Reference Citation
1.	Mouse MP Annotation Import Pipeline	RGD automated import pipeline
2.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
3.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:16954537	PMID:17604727	PMID:17989215	PMID:18256189	PMID:19188439	PMID:19726871	PMID:19922871	PMID:20413612	PMID:21037258	PMID:21267068	PMID:22374132
PMID:23676496	PMID:24137001	PMID:28105427	PMID:30696455	PMID:30936836	PMID:35281804

Genomics

Comparative Map Data

Mir208b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	14	55,213,157 - 55,213,233 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	14	55,213,157 - 55,213,233 (-)	Ensembl		GRCm39 Ensembl
GRCm38	14	54,975,700 - 54,975,776 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	14	54,975,700 - 54,975,776 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	14	55,594,537 - 55,594,613 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	14	52,781,639 - 52,781,715 (-)	NCBI		Celera
Cytogenetic Map	14	C3	NCBI

MIR208B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	14	23,417,987 - 23,418,063 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	14	23,417,987 - 23,418,063 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	14	23,887,196 - 23,887,272 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	14	22,957,035 - 22,957,111 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	14	3,749,891 - 3,749,967 (-)	NCBI		Celera
Cytogenetic Map	14	q11.2	NCBI
HuRef	14	4,003,632 - 4,003,708 (-)	NCBI		HuRef
CHM1_1	14	23,885,868 - 23,885,944 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	14	17,618,991 - 17,619,067 (-)	NCBI		T2T-CHM13v2.0

Mir208b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	15	28,451,638 - 28,451,749 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	15	28,451,638 - 28,451,749 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	15	30,297,322 - 30,297,433 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	15	31,444,521 - 31,444,632 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	15	29,687,213 - 29,687,324 (-)	NCBI	Rnor_WKY
Rnor_6.0	15	33,639,510 - 33,639,621 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	15	33,639,510 - 33,639,621 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	15	37,526,109 - 37,526,220 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	15	28,029,311 - 28,029,422 (-)	NCBI		Celera
Cytogenetic Map	15	p13	NCBI

MIR208B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	8	3,665,163 - 3,665,236 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	8	3,665,163 - 3,665,236 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
ROS_Cfam_1.0	8	3,772,895 - 3,772,968 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	8	3,464,425 - 3,464,498 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	8	3,525,897 - 3,525,970 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	8	3,787,921 - 3,787,994 (-)	NCBI		UU_Cfam_GSD_1.0

MIR208B
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	7	75,667,786 - 75,667,865 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	7	75,667,786 - 75,667,865 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	7	81,071,323 - 81,071,402 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Variants

Variants in Mir208b
3 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	15662
Count of gene targets:	7031
Count of transcripts:	11355
Interacting mature miRNAs:	mmu-miR-208b-3p, mmu-miR-208b-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357589	Kdnw2_m	kidney weight 2 (mouse)			Not determined		14	20887473	121269804	Mouse
1357527	Epfpq1_m	epididymal fat percentage QTL 1 (mouse)			Not determined		14	21062450	71885801	Mouse
14746973	Manh76_m	mandible shape 76 (mouse)					14	22287217	56287217	Mouse
4142485	Modor2_m	modifier of ocular retardation 2 (mouse)			Not determined		14	24926248	58179769	Mouse
13506929	Recrq10_m	recombination rate in male meiosis QTL 10 (mouse)					14	27921957	61137449	Mouse
10043886	Cia49_m	collagen induced arthritis QTL 49 (mouse)			Not determined		14	29996994	63997133	Mouse
27226774	Tibl15_m	tibia length 15, 10 week (mouse)					14	30321957	87937436	Mouse
1300909	Ath13_m	atherosclerosis 13 (mouse)			Not determined		14	30335250	64335381	Mouse
1300998	Cia17_m	collagen induced arthritis 17 (mouse)			Not determined		14	30335250	64335381	Mouse
27226737	Metcl12_m	metatarsal-calcaneal length 12, 10 week (mouse)					14	33221957	59437449	Mouse
1300625	Cosz2_m	cocaine seizure 2 (mouse)			Not determined		14	35045797	68785736	Mouse
10043887	Cia50_m	collagen induced arthritis QTL 50 (mouse)			Not determined		14	37430185	71430320	Mouse
4142419	Tgq26_m	triglyceride QTL 26 (mouse)			Not determined			40337319	74337319	Mouse
1301777	Bglq15_m	body growth late QTL 15 (mouse)			Not determined		14	42962416	76962593	Mouse
1301424	Skull21_m	skull morphology 21 (mouse)			Not determined		14	42962416	76962593	Mouse
1300805	Mors3_m	modifier of obesity related sterility 3 (mouse)			Not determined		14	43037270	77037418	Mouse
1301091	Bbaa21_m	B.burgdorferi-associated arthritis 21 (mouse)			Not determined		14	43065847	77066045	Mouse
4141400	Nilac8_m	nicotine induced locomotor activity 8 (mouse)			Not determined		14	43065847	77066045	Mouse
4141484	Hcbip1_m	hexachlorobenzene induced porphyria 1 (mouse)			Not determined			47335250	59962593	Mouse
1300605	El5_m	epilepsy 5 (mouse)			Not determined		14	49455425	83455556	Mouse
4142364	Pbwg18_m	postnatal body weight growth 18 (mouse)			Not determined		14	52281984	86282125	Mouse
1301489	Lbm10_m	lean body mass 10 (mouse)			Not determined		14	53761296	87761529	Mouse
12880432	Fgf23lq3_m	FGF23 serum level QTL 3 (mouse)					14	53937440	87937440	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_030607	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	CT025533	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609958	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000104735

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	14	55,213,157 - 55,213,233 (-)	Ensembl
GRCm38.p6 Ensembl	14	54,975,700 - 54,975,776 (-)	Ensembl

RefSeq Acc Id:

NR_030607

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	14	55,213,157 - 55,213,233 (-)	NCBI
GRCm38	14	54,975,700 - 54,975,776 (-)	ENTREZGENE
MGSCv37	14	55,594,537 - 55,594,613 (-)	RGD
Celera	14	52,781,639 - 52,781,715 (-)	RGD
cM Map	14		ENTREZGENE

Sequence:

show sequence

CCTCTCAGGGAAGCTTTTTGCTCGCGTTATGTTTCTCATCCGAATATAAGACGAACAAAAGGTT
TGTCTGAGGGCTG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3718461	AgrOrtholog
Ensembl Genes	ENSMUSG00000077928	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000104735	ENTREZGENE
MGD	MGI:3718461	ENTREZGENE
miRBase	MI0005552	ENTREZGENE
NCBI Gene	100124433	ENTREZGENE
PhenoGen	Mir208b	PhenoGen
RNAcentral	URS000034979B	RNACentral
	URS0000508226	RNACentral
	URS000075BCD9	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar

Mammalian Phenotype