Mir467e (microRNA 467e) - Rat Genome Database

Name: Mir467e
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir467e (microRNA 467e) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir467e

Name:

microRNA 467e

Description:

Localizes to the RISC complex.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

Mirn467e

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	2	10,505,721 - 10,505,807 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
Celera	2	10,431,470 - 10,431,546 (+)	NCBI		Celera
Cytogenetic Map	2	A1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cisplatin	increases expression	EXP		6480464	Cisplatin results in increased expression of MIR467E mRNA	CTD	PMID:28119452
sodium fluoride	increases expression	EXP		6480464	Sodium Fluoride results in increased expression of MIR467E mRNA	CTD	PMID:29127033
streptozocin	decreases expression	EXP		6480464	Streptozocin results in decreased expression of MIR467E mRNA	CTD	PMID:27629361
zearalenone	decreases expression	EXP		6480464	Zearalenone results in decreased expression of MIR467E mRNA	CTD	PMID:30717214

Gene Ontology Annotations

Cellular Component

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RISC complex		IDA		2290270	(MGI:MGI:5507918, PMID:23185045)	MGI	MGI:MGI:5507918, PMID:23185045

Gene-Chemical Interaction Annotations

	cisplatin (EXP)
	sodium fluoride (EXP)

	streptozocin (EXP)
	zearalenone (EXP)

Gene Ontology Annotations

Cellular Component

RISC complex (IDA)

References - uncurated

PubMed

16381832 17604727 20215419 20413612 21267068 23185045

Genomics

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10045633	Heal15_m	wound healing/regeneration 15 (mouse)			Not determined		2	1	21984831	Mouse
4142333	Tgq10_m	triglyceride QTL 10 (mouse)			Not determined			1	25319748	Mouse
4141836	Tgq11_m	triglyceride QTL 11 (mouse)			Not determined			1	25319748	Mouse
1301838	Sluc16_m	susceptibility to lung cancer 16 (mouse)			Not determined		2	1	26524778	Mouse
12904743	Carcdq3_m	cardiac collagen deposition QTL 3 (mouse)					2	3233903	28289138	Mouse
1301769	Orgwq2_m	organ weight QTL 2 (mouse)			Not determined		2	3886089	93591306	Mouse
1301980	Fcsa5_m	femoral cross-sectional area 5 (mouse)			Not determined		2	7789103	41789249	Mouse
1301790	Pcfm1_m	periosteal circumference and femur length 1 (mouse)			Not determined		2	8346284	42346384	Mouse
10043876	Adip22_m	adiposity 22 (mouse)			Not determined		2	8418039	42418228	Mouse
1300624	Insq7_m	insulin QTL 7 (mouse)			Not determined		2	9494434	43494563	Mouse
10755513	Amzn4_m	anatomical modifier of Zfp423 4 (mouse)					2	9494434	43494563	Mouse
12903993	Opfaq1_m	open field activity QTL 1 (mouse)					2	9671880	27132630	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	22079
Count of gene targets:	8160
Count of transcripts:	13306
Interacting mature miRNAs:	mmu-miR-467e-3p, mmu-miR-467e-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_030645	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL772216	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_030645

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	2	10,505,721 - 10,505,807 (+)	NCBI
Celera	2	10,431,470 - 10,431,546 (+)	NCBI

Sequence:

show sequence

GCCTGTGTGCATAAGTGTGAGCATGTATATGTGTGTATATTTTATGCATATACATACACACACC
TATATACACATGCACACAGACAT

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000076948	ENTREZGENE
Ensembl Transcript	ENSMUST00000103760	ENTREZGENE
MGD	MGI:3718541	ENTREZGENE
miRBase	MI0006128	ENTREZGENE
NCBI Gene	100124448	ENTREZGENE
PhenoGen	Mir467e	PhenoGen
RNAcentral	URS0000547066	RNACentral
	URS00005CC853	RNACentral
	URS000075D0CC	RNACentral

More on Mir467e
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	2314095
Created:	2009-10-30
Species:	Mus musculus
Last Modified:	2019-11-27
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.