Mir877 (microRNA 877) - Rat Genome Database

Name: Mir877
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir877 (microRNA 877) Mus musculus

Analyze

Symbol:

Mir877

Name:

microRNA 877

RGD ID:

2314086

MGI Page

MGI

Description:

Involved in cell aging. Orthologous to human MIR877 (microRNA 877).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-877; Mirn; Mirn877; mmu-mir-8; mmu-mir-877

RGD Orthologs

Human

Rat

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	17	36,271,622 - 36,271,706 (-)	NCBI	GRCm39		mm39
GRCm38	17	35,960,730 - 35,960,814 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	17	35,960,730 - 35,960,814 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	17	36,097,675 - 36,097,759 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	17	39,474,255 - 39,474,339 (-)	NCBI		Celera
Cytogenetic Map	17	B1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Chemical and Drug Induced Liver Injury (ISO)

Neoplastic Cell Transformation (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,2-dichloroethane (EXP)

1,4-dichlorobenzene (EXP)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2,5-hexanedione (ISO)

benzene (EXP)

bis(2-ethylhexyl) phthalate (EXP)

catechol (EXP)

methapyrilene (ISO)

mono(2-ethylhexyl) phthalate (EXP)

nitrofen (ISO)

p-cresol (EXP)

paracetamol (ISO)

phenol (EXP)

silver atom (ISO)

silver(0) (ISO)

tetrachloromethane (ISO)

titanium dioxide (EXP)

tributyl phosphate (EXP)

trichloroethene (EXP)

trovafloxacin (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cell aging (IDA)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:16954537	PMID:17604727	PMID:17964270	PMID:20215419	PMID:20413612	PMID:21037258	PMID:21267068	PMID:25751060

Genomics

Comparative Map Data

Mir877
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	17	36,271,622 - 36,271,706 (-)	NCBI	GRCm39		mm39
GRCm38	17	35,960,730 - 35,960,814 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	17	35,960,730 - 35,960,814 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	17	36,097,675 - 36,097,759 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	17	39,474,255 - 39,474,339 (-)	NCBI		Celera
Cytogenetic Map	17	B1	NCBI

MIR877
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	6	30,584,332 - 30,584,417 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	6	30,584,332 - 30,584,417 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	6	30,552,109 - 30,552,194 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	6	30,660,087 - 30,660,172 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	6	32,150,226 - 32,150,311 (+)	NCBI
Cytogenetic Map	6	p21.33	NCBI
HuRef	6	30,352,183 - 30,352,268 (+)	NCBI		HuRef
CHM1_1	6	30,554,223 - 30,554,308 (+)	NCBI		CHM1_1

Mir877
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	20	2,811,476 - 2,811,560 (+)	NCBI
Rnor_6.0 Ensembl	20	3,318,872 - 3,318,956 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	20	3,318,872 - 3,318,956 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	20	5,416,400 - 5,416,484 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	20	237,323 - 237,407 (+)	NCBI		Celera
Cytogenetic Map	20	p12	NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10412276	Leci2_m	leukocyte endothelial cell interactions 2 (mouse)			Not determined		17	3127913	37128037	Mouse
1300890	Bhr3_m	bronchial hyperresponsiveness 3 (mouse)			Not determined		17	3924615	48559063	Mouse
4141215	Mnic1_m	macronutrient intake, carbohydrate 1 (mouse)			Not determined			4804477	45359340	Mouse
1300706	Alan1_m	alloantigen response 1 (mouse)			Not determined		17	4804477	46158776	Mouse
1357789	Kdnw3_m	kidney weight 3 (mouse)			Not determined		17	4804477	47574740	Mouse
4141272	Tfv1_m	total food volume 1 (mouse)			Not determined			4804477	65330362	Mouse
10043949	Pbft7_m	percent body fat 7 (mouse)			Not determined		17	6674962	40674962	Mouse
1301935	Skull24_m	skull morphology 24 (mouse)			Not determined		17	8365940	42366175	Mouse
1300787	Cd8mts5_m	CD8 memory T cell subset 5 (mouse)			Not determined		17	8365940	42366175	Mouse
1301338	Lmr1_m	leishmaniasis resistance 1 (mouse)			Not determined		17	9862411	86688972	Mouse
1302028	Asbb3_m	autoimmune susceptibility in C57BL/6J and BALB/c 3 (mouse)			Not determined		17	10659145	44659245	Mouse
4142342	Lfnq4_m	lung function QTL 4 (mouse)			Not determined			10987597	39053168	Mouse
4141067	Hbnr2_m	Heligmosomoides bakeri nematode resistance 2 (mouse)			Not determined			11666997	45667145	Mouse
14747010	Mancz14_m	mandible centroid size 14 (mouse)					17	11779210	45779210	Mouse
4142150	Stheal11_m	soft tissue heal 11 (mouse)			Not determined		17	12067324	83054339	Mouse
12904946	Tammq8_m	tibialis anterior muscle mass QTL 8 (mouse)					17	12232813	46232813	Mouse
13524847	Asrq8a_m	acoustic startle response 8a (mouse)					17	12427987	46427987	Mouse
11081168	Tir7_m	trypanosome infection response 7 (mouse)					17	13904398	47904522	Mouse
1300914	Pcir4_m	periosteal circumference 4 (mouse)			Not determined		17	14842678	48842786	Mouse
1558886	Lgth9_m	body length 9 (mouse)			Not determined		17	14842678	48842786	Mouse
1302070	Tbbmd7_m	total body bone mineral density 7 (mouse)			Not determined		17	14842678	48842786	Mouse
1300995	Fembrs4_m	femur breaking strength 4 (mouse)			Not determined		17	14842678	48842786	Mouse
1302140	Wta4_m	weight adult 4 (mouse)			Not determined		17	16600747	50600869	Mouse
1302152	Skull25_m	skull morphology 25 (mouse)			Not determined		17	16600747	50600869	Mouse
1301505	Tir1_m	trypanosome infection response 1 (mouse)			Not determined		17	16600747	50600869	Mouse
10412083	Sm2_m	susceptibility to Schistosoma mansoni infection 2 (mouse)			Not determined		17	16810969	50811104	Mouse
1302042	Acsns3_m	Angiostrongylus costaricensis nematode susceptibility 3 (mouse)			Not determined		17	17243234	51243371	Mouse
1300535	Char3_m	P. chabaudi malaria resistance QTL 3 (mouse)			Not determined		17	17243234	51243371	Mouse
10412214	Sxbq3_m	SGC/Knj cross B6 QTL 3 (mouse)			Not determined		17	17243234	51243371	Mouse
13452396	Leusq3_m	leucocytosis susceptibility QTL 3 (mouse)					17	17243234	51243371	Mouse
13452399	Leusq6_m	leucocytosis susceptibility QTL 6 (mouse)					17	17243234	51243371	Mouse
1301840	Ssial4_m	susceptibility to sialadenitiss 4 (mouse)			Not determined		17	17956436	51959238	Mouse
1301331	Lbw1_m	lupus NZB x NZW 1 (mouse)			Not determined		17	18199381	52202007	Mouse
1301056	Pas2_m	pulmonary adenoma susceptibility 2 (mouse)			Not determined		17	18203165	52205351	Mouse
15039354	Nmrs36_m	NAFLD-associated magnetic resonance shift 36 (mouse)					17	18834133	52834133	Mouse
1301454	Eae5_m	susceptibility to experimental allergic encephalomyelitis 5 (mouse)			Not determined		17	24301859	58301973	Mouse
10412198	Sst5_m	susceptibility to tuberculosis 5 (mouse)			Not determined		17	24857609	55405969	Mouse
10412196	Bbaa28_m	B.burgdorferi-associated arthritis 28 (mouse)			Not determined		17	25365940	43665344	Mouse
10412204	Bbaa29_m	B.burgdorferi-associated arthritis 29 (mouse)			Not determined		17	25740294	59740461	Mouse
1558758	Kcal2_m	kilocalorie 2 (mouse)			Not determined		17	26182038	52604676	Mouse
1300602	Eye2_m	eye weight 2 (mouse)			Not determined		17	26286363	40794146	Mouse
1302005	Loco2_m	locomotor activity 2 (mouse)			Not determined		17	26574081	60574223	Mouse
11075105	Modc1_m	modifier of Odc1 (mouse)					17	27496818	45311728	Mouse
15039348	Nmrs37_m	NAFLD-associated magnetic resonance shift 37 (mouse)					17	27504322	61504322	Mouse
10045977	Tir9_m	trypanosome infection response 9 (mouse)			Not determined		17	27659145	43574223	Mouse
1300703	Uvbi2_m	UVB induced immunosuppression 2 (mouse)			Not determined		17	28311480	62311728	Mouse
1300589	Myaa2_m	modifier of Yaa 2 (mouse)			Not determined		17	29821629	63821740	Mouse
4140955	Plgr1_m	plague resistance locus 1 (mouse)			Not determined			30722575	64722705	Mouse
4141357	Mrdq1_m	modifier of retinal degeneration QTL 1 (mouse)			Not determined			30768929	47728778	Mouse
1300692	Blmpf1_m	bleomycin-induced pulmonary fibrosis 1 (mouse)			Not determined		17	31842678	37333884	Mouse
26884379	Skwq5_m	skull length QTL 5, 5 week (mouse)					17	32900000	53800000	Mouse
1300885	Mbis4_m	Mycobacterium bovis-induced systemic lupus erythematosus 4 (mouse)			Not determined		17	34956841	69858931	Mouse
10755514	Amzn2_m	anatomical modifier of Zfp423 2 (mouse)					17	35659266	69659396	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	31982
Count of gene targets:	12212
Count of transcripts:	21322
Interacting mature miRNAs:	mmu-miR-877-3p, mmu-miR-877-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_030608	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	CR974451	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CU457375	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CU463331	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609959	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000104738

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	17	35,960,730 - 35,960,814 (-)	Ensembl

RefSeq Acc Id:

NR_030608

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	17	36,271,622 - 36,271,706 (-)	NCBI
GRCm38	17	35,960,730 - 35,960,814 (-)	ENTREZGENE
MGSCv37	17	36,097,675 - 36,097,759 (-)	RGD
Celera	17	39,474,255 - 39,474,339 (-)	RGD
cM Map	17		ENTREZGENE

Sequence:

show sequence

GTAGAGGAGATGGCGCAGGGGACACAAGGTAGGCCTTGCGGGTCTGTGGACCCTTGGACATGTG
TCCTCTTCTCCCTCCTCCCAG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3718567	AgrOrtholog
Ensembl Genes	ENSMUSG00000077931	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000104738	ENTREZGENE
MGD	MGI:3718567	ENTREZGENE
miRBase	MI0005553	ENTREZGENE
NCBI Gene	100124459	ENTREZGENE
PhenoGen	Mir877	PhenoGen
RNAcentral	URS00005240FD	RNACentral
	URS0000584A54	RNACentral
	URS00006751F8	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD