MIR1247 (microRNA 1247) - Rat Genome Database

Name: MIR1247
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner VCMap Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR1247 (microRNA 1247) Homo sapiens

Analyze

Symbol:

MIR1247

Name:

microRNA 1247

RGD ID:

2312974

HGNC Page

HGNC

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

hsa-mir-1247; mir-1247; MIRN1247

RGD Orthologs

Mouse

Alliance Genes

More Info

more info ...

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	14	101,560,287 - 101,560,422 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	14	101,560,287 - 101,560,422 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	14	102,026,624 - 102,026,759 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Celera	14	82,081,713 - 82,081,848 (-)	NCBI
Cytogenetic Map	14	q32.31	NCBI
HuRef	14	82,209,325 - 82,209,460 (-)	NCBI		HuRef
CHM1_1	14	101,965,105 - 101,965,240 (-)	NCBI		CHM1_1

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Chemical and Drug Induced Liver Injury (EXP)

thyroid gland papillary carcinoma (EXP)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

cadmium atom (EXP)

catechol (ISO)

ethanol (ISO)

microcystin-LR (EXP)

N-acetyl-L-cysteine (EXP)

paracetamol (EXP)

phenol (ISO)

silver atom (EXP)

silver(0) (EXP)

sodium fluoride (ISO)

tetrachloromethane (ISO)

References

References - curated


1.	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
2.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:18285502	PMID:21037258	PMID:24014021	PMID:24785261	PMID:25731699	PMID:25973030	PMID:28460450	PMID:28586038	PMID:29335551	PMID:29768218	PMID:29793538
PMID:29872024	PMID:30175411	PMID:30249392	PMID:30312173	PMID:30318507	PMID:30378132	PMID:30967263	PMID:31539113	PMID:32131485	PMID:32366555

Genomics

Comparative Map Data

MIR1247
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	14	101,560,287 - 101,560,422 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	14	101,560,287 - 101,560,422 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	14	102,026,624 - 102,026,759 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Celera	14	82,081,713 - 82,081,848 (-)	NCBI
Cytogenetic Map	14	q32.31	NCBI
HuRef	14	82,209,325 - 82,209,460 (-)	NCBI		HuRef
CHM1_1	14	101,965,105 - 101,965,240 (-)	NCBI		CHM1_1

Mir1247
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	12	110,244,482 - 110,244,563 (-)	NCBI	GRCm39		mm39
GRCm39 Ensembl	12	110,244,482 - 110,244,563 (-)	Ensembl
GRCm38	12	110,278,048 - 110,278,129 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	12	110,278,048 - 110,278,129 (-)	Ensembl	GRCm38		mm10	GRCm38
Celera	12	111,468,520 - 111,468,601 (-)	NCBI		Celera
Cytogenetic Map	12	F1	NCBI
cM Map	12	60.56	NCBI

Position Markers

STS-S79854

Human Assembly	Chr	Position (strand)	Source	JBrowse
GRCh37	14	102,028,757 - 102,029,043	UniSTS	GRCh37
Build 36	14	101,098,510 - 101,098,796	RGD	NCBI36
Celera	14	82,083,846 - 82,084,132	RGD
Cytogenetic Map	14	q32	UniSTS
HuRef	14	82,211,107 - 82,211,393	UniSTS
GeneMap99-GB4 RH Map	14	277.83	UniSTS

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
RPL35A	hsa-miR-1247-5p	Mirtarbase	external_info	CLASH	Functional MTI (Weak)	23622248

Predicted Targets

	Summary Value
Count of predictions:	40536
Count of gene targets:	14514
Count of transcripts:	33309
Interacting mature miRNAs:	hsa-miR-1247-3p, hsa-miR-1247-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031649	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL049836	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM610143	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENST00000408206

RefSeq Status:

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p13 Ensembl	14	101,560,287 - 101,560,422 (-)	Ensembl

RefSeq Acc Id:

NR_031649

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	14	101,560,287 - 101,560,422 (-)	NCBI
GRCh37	14	102,026,624 - 102,026,759 (-)	RGD
Celera	14	82,081,713 - 82,081,848 (-)	RGD
HuRef	14	82,209,325 - 82,209,460 (-)	ENTREZGENE
CHM1_1	14	101,965,105 - 101,965,240 (-)	NCBI

Sequence:

show sequence

CCGCTTGCCTCGCCCAGCGCAGCCCCGGCCGCTGGGCGCACCCGTCCCGTTCGTCCCCGGACGT
TGCTCTCTACCCCGGGAACGTCGAGACTGGAGCGCCCGAACTGAGCCACCTTCGCGGACCCCGA
GAGCGGCG

hide sequence

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 14q32.2-32.33(chr14:99831655-106855263)x1	copy number loss	See cases [RCV000133831]	Chr14:99831655..106855263 [GRCh38] Chr14:100297992..107263478 [GRCh37] Chr14:99367745..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
NM_001362.3(DIO3):c.574G>A (p.Asp192Asn)	single nucleotide variant	Malignant melanoma [RCV000062706]	Chr14:101562070 [GRCh38] Chr14:102028407 [GRCh37] Chr14:101098160 [NCBI36] Chr14:14q32.31	not provided
NM_001362.3(DIO3):c.536C>T (p.Ala179Val)	single nucleotide variant	Malignant melanoma [RCV000070424]	Chr14:101562032 [GRCh38] Chr14:102028369 [GRCh37] Chr14:101098122 [NCBI36] Chr14:14q32.31	not provided
GRCh38/hg38 14q24.3-32.33(chr14:73655772-106879298)x3	copy number gain	See cases [RCV000134000]	Chr14:73655772..106879298 [GRCh38] Chr14:74122475..107287505 [GRCh37] Chr14:73192228..106358550 [NCBI36] Chr14:14q24.3-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:97638520-106855263)x3	copy number gain	See cases [RCV000135400]	Chr14:97638520..106855263 [GRCh38] Chr14:98104857..107263478 [GRCh37] Chr14:97174610..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:99448012-106850609)x3	copy number gain	See cases [RCV000135875]	Chr14:99448012..106850609 [GRCh38] Chr14:99914349..107258824 [GRCh37] Chr14:98984102..106329869 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q11.2-32.33(chr14:20151149-106855263)x3	copy number gain	See cases [RCV000135543]	Chr14:20151149..106855263 [GRCh38] Chr14:20619308..107263478 [GRCh37] Chr14:19689148..106334523 [NCBI36] Chr14:14q11.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100309382-105987610)x3	copy number gain	See cases [RCV000135410]	Chr14:100309382..105987610 [GRCh38] Chr14:100775719..106453697 [GRCh37] Chr14:99845472..105524742 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.12-32.33(chr14:92540983-104863658)x3	copy number gain	See cases [RCV000135896]	Chr14:92540983..104863658 [GRCh38] Chr14:93007328..105329995 [GRCh37] Chr14:92077081..104401040 [NCBI36] Chr14:14q32.12-32.33	pathogenic
GRCh38/hg38 14q32.13-32.33(chr14:95524407-106879501)x1	copy number loss	See cases [RCV000136032]	Chr14:95524407..106879501 [GRCh38] Chr14:95990744..107287708 [GRCh37] Chr14:95060497..106358753 [NCBI36] Chr14:14q32.13-32.33	pathogenic
GRCh38/hg38 14q24.3-32.33(chr14:77222795-106879298)x3	copy number gain	See cases [RCV000138230]	Chr14:77222795..106879298 [GRCh38] Chr14:77689138..107287505 [GRCh37] Chr14:76758891..106358550 [NCBI36] Chr14:14q24.3-32.33	pathogenic
GRCh38/hg38 14q32.2-32.31(chr14:100262836-102500697)x1	copy number loss	See cases [RCV000139723]	Chr14:100262836..102500697 [GRCh38] Chr14:100729173..102967034 [GRCh37] Chr14:99798926..102036787 [NCBI36] Chr14:14q32.2-32.31	pathogenic
GRCh38/hg38 14q11.2-32.33(chr14:20043514-106877229)x3	copy number gain	See cases [RCV000143373]	Chr14:20043514..106877229 [GRCh38] Chr14:20511673..107285437 [GRCh37] Chr14:19581513..106356482 [NCBI36] Chr14:14q11.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100582059-106877229)x1	copy number loss	See cases [RCV000143662]	Chr14:100582059..106877229 [GRCh38] Chr14:101048396..107285437 [GRCh37] Chr14:100118149..106356482 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100590353-106855264)x1	copy number loss	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051553]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051553]\|See cases [RCV000051553]	Chr14:100590353..106855264 [GRCh38] Chr14:101056690..107263479 [GRCh37] Chr14:100126443..106334524 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:97938637-106855263)x1	copy number loss	See cases [RCV000050696]	Chr14:97938637..106855263 [GRCh38] Chr14:98404974..107263478 [GRCh37] Chr14:97474727..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100309382-106855263)x1	copy number loss	See cases [RCV000050938]	Chr14:100309382..106855263 [GRCh38] Chr14:100775719..107263478 [GRCh37] Chr14:99845472..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100808300-106855263)x1	copy number loss	See cases [RCV000051113]	Chr14:100808300..106855263 [GRCh38] Chr14:101274637..107263478 [GRCh37] Chr14:100344390..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q31.2-32.33(chr14:83912345-106855405)x3	copy number gain	See cases [RCV000052294]	Chr14:83912345..106855405 [GRCh38] Chr14:84378689..107263620 [GRCh37] Chr14:83448442..106334665 [NCBI36] Chr14:14q31.2-32.33	pathogenic
GRCh38/hg38 14q31.3-32.33(chr14:86094030-106832642)x3	copy number gain	See cases [RCV000052295]	Chr14:86094030..106832642 [GRCh38] Chr14:86560374..107240869 [GRCh37] Chr14:85630127..106311914 [NCBI36] Chr14:14q31.3-32.33	pathogenic
GRCh38/hg38 14q32.12-32.33(chr14:91455861-106832642)x3	copy number gain	See cases [RCV000052296]	Chr14:91455861..106832642 [GRCh38] Chr14:91922205..107240869 [GRCh37] Chr14:90991958..106311914 [NCBI36] Chr14:14q32.12-32.33	pathogenic
GRCh38/hg38 14q32.13-32.33(chr14:94628219-106451054)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052298]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052298]\|See cases [RCV000052298]	Chr14:94628219..106451054 [GRCh38] Chr14:95094556..106906960 [GRCh37] Chr14:94164309..105978005 [NCBI36] Chr14:14q32.13-32.33	pathogenic
GRCh38/hg38 14q32.31(chr14:101534151-101561708)x3	copy number gain	See cases [RCV000052091]	Chr14:101534151..101561708 [GRCh38] Chr14:102000488..102028045 [GRCh37] Chr14:101070241..101097798 [NCBI36] Chr14:14q32.31	uncertain significance

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	HGNC:35313	AgrOrtholog
COSMIC	MIR1247	COSMIC
Ensembl Genes	ENSG00000283857	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000408206	ENTREZGENE
GTEx	ENSG00000283857	GTEx
HGNC ID	HGNC:35313	ENTREZGENE
Human Proteome Map	MIR1247	Human Proteome Map
miRBase	MI0006382	ENTREZGENE
NCBI Gene	100302145	ENTREZGENE
PharmGKB	PA164722386	PharmGKB
RNAcentral	URS000032835F	RNACentral
	URS000057DF36	RNACentral
	URS000075C329	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD