MIR744 (microRNA 744) - Rat Genome Database

Name: MIR744
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR744 (microRNA 744) Homo sapiens

Analyze

Symbol:

MIR744

Name:

microRNA 744

RGD ID:

2290242

HGNC Page

HGNC

Description:

Predicted to be involved in several processes, including SMAD protein signal transduction; cellular response to forskolin; and positive regulation of gene expression. Predicted to localize to RISC complex.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

hsa-mir-744; mir-744; MIRN744

RGD Orthologs

Mouse

Pig

Alliance Genes

More Info

more info ...

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	17	12,081,899 - 12,081,996 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	17	12,081,899 - 12,081,996 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	17	11,985,216 - 11,985,313 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	11,925,940 - 11,926,037 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	17	12,015,760 - 12,015,857 (+)	NCBI
Cytogenetic Map	17	p12	NCBI
HuRef	17	11,885,973 - 11,886,070 (+)	NCBI		HuRef
CHM1_1	17	11,994,325 - 11,994,422 (+)	NCBI		CHM1_1

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Chemical and Drug Induced Liver Injury (EXP)

Myocardial Reperfusion Injury (EXP)

type 2 diabetes mellitus (EXP)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

2-hydroxypropanoic acid (EXP)

biphenyl-4-amine (EXP)

bis(2-chloroethyl) sulfide (ISO)

carbon nanotube (EXP)

cisplatin (ISO)

doxorubicin (EXP)

hydrogen peroxide (EXP)

methimazole (ISO)

paracetamol (EXP)

rac-lactic acid (EXP)

radon atom (EXP)

radon(0) (EXP)

S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)

sodium arsenite (ISO)

sodium fluoride (ISO)

streptozocin (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to forskolin (ISO)

cellular response to leukemia inhibitory factor (ISO)

histone H3-S10 phosphorylation involved in chromosome condensation (ISO)

long-term synaptic potentiation (ISO)

positive regulation of cell cycle (ISO)

positive regulation of fibroblast proliferation (ISO)

positive regulation of gene expression (ISO)

positive regulation of gene expression, epigenetic (ISO)

positive regulation of transcription by RNA polymerase II (ISO)

regulation of miRNA metabolic process (ISO)

regulation of RNA polymerase II regulatory region sequence-specific DNA binding (ISO)

response to bacterium (ISO)

sensory perception of sound (ISO)

SMAD protein signal transduction (ISO)

Cellular Component

RISC complex (ISO)

Molecular Function

protein binding (ISO)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:16954537	PMID:17604727	PMID:21037258	PMID:21991303	PMID:23695020	PMID:25543521	PMID:25961434	PMID:26259828	PMID:26485754	PMID:26505678	PMID:26646931
PMID:27261616	PMID:27533461	PMID:27533465	PMID:28107193	PMID:28766230	PMID:28791400	PMID:29899543	PMID:30392569	PMID:30542724	PMID:30628685	PMID:30664260	PMID:31211984
PMID:31292221	PMID:31522607	PMID:31553714	PMID:31884801	PMID:32335029	PMID:32366870

Genomics

Comparative Map Data

MIR744
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	17	12,081,899 - 12,081,996 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	17	12,081,899 - 12,081,996 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	17	11,985,216 - 11,985,313 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	11,925,940 - 11,926,037 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	17	12,015,760 - 12,015,857 (+)	NCBI
Cytogenetic Map	17	p12	NCBI
HuRef	17	11,885,973 - 11,886,070 (+)	NCBI		HuRef
CHM1_1	17	11,994,325 - 11,994,422 (+)	NCBI		CHM1_1

Mir744
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	65,625,559 - 65,625,658 (-)	NCBI	GRCm39		mm39
GRCm38	11	65,734,733 - 65,734,832 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	65,734,733 - 65,734,832 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	65,548,235 - 65,548,334 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	11	72,669,661 - 72,669,760 (-)	NCBI		Celera
Cytogenetic Map	11	B3	NCBI

MIR744
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	12	56,464,848 - 56,464,927 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	12	56,464,848 - 56,464,927 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	12	59,358,203 - 59,358,282 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
AGPAT3	hsa-miR-744-5p	Mirtarbase	external_info	CLASH	Functional MTI (Weak)	23622248
IER5	hsa-miR-744-5p	Tarbase	external_info	Sequencing	POSITIVE
ARL15	hsa-miR-744-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	20371350
BUB3	hsa-miR-744-3p	Mirtarbase	external_info	CLASH	Functional MTI (Weak)	23622248

Predicted Targets

	Summary Value
Count of predictions:	69096
Count of gene targets:	21805
Count of transcripts:	56977
Interacting mature miRNAs:	hsa-miR-744-3p, hsa-miR-744-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	sensory system	adipose tissue	appendage	entire extraembryonic component
High
Medium	1	1	1		4			1
Low	74	60	100	41	234	37	161	35	123	90	163	162	7	14	46	1
Below cutoff	101	78	87	26	80	20	123	65	183	42	79	89	10	38	61	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NG_033952	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NR_030613	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC005410	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609964	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENST00000578242

RefSeq Status:

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p13 Ensembl	17	12,081,899 - 12,081,996 (+)	Ensembl

RefSeq Acc Id:

NR_030613

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	17	12,081,899 - 12,081,996 (+)	NCBI
GRCh37	17	11,985,216 - 11,985,313 (+)	RGD
Celera	17	12,015,760 - 12,015,857 (+)	RGD
HuRef	17	11,885,973 - 11,886,070 (+)	RGD
CHM1_1	17	11,994,325 - 11,994,422 (+)	NCBI

Sequence:

show sequence

TTGGGCAAGGTGCGGGGCTAGGGCTAACAGCAGTCTTACTGAAGGTTTCCTGGAAACCACGCAC
ATGCTGTTGCCACTAACCTCAACCTTACTCGGTC

hide sequence

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 17p13.2-12(chr17:5732953-12095349)x3	copy number gain	See cases [RCV000134851]	Chr17:5732953..12095349 [GRCh38] Chr17:5636273..11998666 [GRCh37] Chr17:5576997..11939391 [NCBI36] Chr17:17p13.2-12	pathogenic
GRCh38/hg38 17p13.3-12(chr17:162016-12343901)x3	copy number gain	See cases [RCV000138531]	Chr17:162016..12343901 [GRCh38] Chr17:45835..12247218 [GRCh37] Chr17:11807..12187943 [NCBI36] Chr17:17p13.3-12	pathogenic
GRCh38/hg38 17p13.3-12(chr17:150732-14764202)x3	copy number gain	See cases [RCV000142236]	Chr17:150732..14764202 [GRCh38] Chr17:525..14667519 [GRCh37] Chr17:525..14608244 [NCBI36] Chr17:17p13.3-12	pathogenic
GRCh38/hg38 17p12-11.2(chr17:10892259-17964282)x3	copy number gain	See cases [RCV000052476]	Chr17:10892259..17964282 [GRCh38] Chr17:10795576..17867596 [GRCh37] Chr17:10736301..17808321 [NCBI36] Chr17:17p12-11.2	pathogenic

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	HGNC:33658	AgrOrtholog
COSMIC	MIR744	COSMIC
Ensembl Genes	ENSG00000266297	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000578242	ENTREZGENE
GTEx	ENSG00000266297	GTEx
HGNC ID	HGNC:33658	ENTREZGENE
Human Proteome Map	MIR744	Human Proteome Map
miRBase	MI0005559	ENTREZGENE
NCBI Gene	100126313	ENTREZGENE
PharmGKB	PA164722971	PharmGKB
RNAcentral	URS00000EC1BE	RNACentral
	URS00002ED61F	RNACentral
	URS00005FAA14	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD