Advanced Search (OLGA)

Gene: Ceacam6 (CEA cell adhesion molecule 6) Rattus norvegicus

Analyze

Symbol:

Ceacam6

Name:

CEA cell adhesion molecule 6

RGD ID:

1642421

Description:

Predicted to enable identical protein binding activity; protein heterodimerization activity; and protein tyrosine kinase binding activity. Predicted to be involved in several processes, including heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules; homophilic cell adhesion via plasma membrane adhesion molecules; and positive regulation of cell adhesion. Predicted to be located in apical plasma membrane and extracellular space. Predicted to be active in cell surface and plasma membrane. Orthologous to several human genes including CEACAM6 (CEA cell adhesion molecule 6); PSG4 (pregnancy specific beta-1-glycoprotein 4); and PSG6 (pregnancy specific beta-1-glycoprotein 6); INTERACTS WITH 6-propyl-2-thiouracil; bisphenol A; copper atom.

Type:

ncrna (Ensembl: protein-coding)

RefSeq Status:

VALIDATED

Previously known as:

carcinoembryonic antigen-related cell adhesion molecule 1-like; carcinoembryonic antigen-related cell adhesion molecule 6; carcinoembryonic antigen-related cell adhesion molecule 6-like; LOC103689938; MGC93832

RGD Orthologs

Human

Bonobo

Green Monkey

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	89,544,415 - 89,562,552 (+)	NCBI		GRCr8
mRatBN7.2	1	80,416,531 - 80,434,668 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	80,416,531 - 80,434,668 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	85,809,061 - 85,827,197 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	94,359,932 - 94,378,069 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	87,564,825 - 87,582,957 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	81,683,500 - 81,701,230 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	81,683,463 - 81,701,317 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	84,300,780 - 84,318,732 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Rnor_5.0	1	82,940,564 - 82,958,486 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	1	80,110,384 - 80,129,016 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	1	75,527,118 - 75,528,059 (-)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Carpenter syndrome 2 (ISO)

congenital hypoplastic anemia (ISO)

craniosynostosis 1 (ISO)

Diamond-Blackfan anemia (ISO)

maple syrup urine disease (ISO)

Parkinson's disease (ISO)

schizophrenia (ISO)

Spontaneous Abortions (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1-methylphenanthrene (ISO)

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

3-isobutyl-1-methyl-7H-xanthine (ISO)

5-aza-2'-deoxycytidine (ISO)

6-propyl-2-thiouracil (EXP)

8-Br-cAMP (ISO)

all-trans-retinoic acid (ISO)

arotinoid acid (ISO)

arsane (ISO)

arsenic atom (ISO)

Azaspiracid (ISO)

benzo[a]pyrene (ISO)

beta-lapachone (ISO)

bisphenol A (EXP)

butanal (ISO)

cadmium atom (ISO)

cadmium dichloride (ISO)

calcitriol (ISO)

CGP 52608 (ISO)

CHIR 99021 (ISO)

clothianidin (ISO)

cobalt dichloride (ISO)

copper atom (EXP)

copper(0) (EXP)

cortisol (ISO)

Cuprizon (EXP)

dexamethasone (ISO)

dibenzo[a,l]pyrene (ISO)

dimethylarsinic acid (ISO)

L-ascorbic acid (ISO)

L-ascorbic acid 2-phosphate (ISO)

lipopolysaccharide (ISO)

methotrexate (ISO)

nickel atom (ISO)

ozone (ISO)

paraquat (ISO)

progesterone (ISO)

rotenone (ISO)

S-(1,2-dichlorovinyl)-L-cysteine (ISO)

SB 431542 (ISO)

silicon dioxide (ISO)

sodium arsenite (ISO)

tamibarotene (ISO)

Tanshinone I (ISO)

tetrathiomolybdate(2-) (ISO)

vinclozolin (EXP)

XAV939 (ISO)

zinc dichloride (ISO)

zoledronic acid (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules (ISO)

homophilic cell adhesion via plasma membrane adhesion molecules (ISO)

negative regulation of anoikis (ISO)

positive regulation of cell migration (ISO)

positive regulation of cell population proliferation (ISO)

positive regulation of endothelial cell-matrix adhesion via fibronectin (ISO)

positive regulation of heterotypic cell-cell adhesion (ISO)

regulation of immune system process (IBA)

signal transduction (IBA)

Cellular Component

apical plasma membrane (ISO)

cell surface (IBA,ISO)

extracellular space (ISO)

membrane (IEA,ISO)

plasma membrane (IBA)

Molecular Function

identical protein binding (ISO)

protein binding (ISO)

protein heterodimerization activity (ISO)

protein tyrosine kinase binding (IBA)

References

References - curated

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:2317824	PMID:2803308	PMID:8776764	PMID:10436421	PMID:10910050	PMID:11590190	PMID:12477932	PMID:16204051	PMID:18685128	PMID:21982860	PMID:23106565	PMID:25171863
PMID:25645918	PMID:26483485

Genomics

Comparative Map Data

Ceacam6
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	89,544,415 - 89,562,552 (+)	NCBI		GRCr8
mRatBN7.2	1	80,416,531 - 80,434,668 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	80,416,531 - 80,434,668 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	85,809,061 - 85,827,197 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	94,359,932 - 94,378,069 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	87,564,825 - 87,582,957 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	81,683,500 - 81,701,230 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	81,683,463 - 81,701,317 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	84,300,780 - 84,318,732 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Rnor_5.0	1	82,940,564 - 82,958,486 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	1	80,110,384 - 80,129,016 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	1	75,527,118 - 75,528,059 (-)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

CEACAM6
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	41,755,530 - 41,772,211 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	19	41,750,977 - 41,772,211 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	19	42,259,438 - 42,276,116 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	46,951,341 - 46,967,953 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	19	46,951,340 - 46,967,953	NCBI
Celera	19	39,059,109 - 39,075,821 (+)	NCBI		Celera
Cytogenetic Map	19	q13.2	NCBI
HuRef	19	38,691,297 - 38,708,013 (+)	NCBI		HuRef
CHM1_1	19	42,261,025 - 42,277,743 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	19	44,574,887 - 44,591,561 (+)	NCBI		T2T-CHM13v2.0

LOC100976543
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	20	47,865,319 - 48,776,239 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	19	49,734,247 - 50,644,888 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	19	38,648,451 - 39,559,050 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	19	47,154,101 - 47,169,691 (+)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	19	47,154,101 - 47,169,691 (+)	Ensembl	panpan1.1		panPan2

CEACAM6
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	6	35,986,767 - 36,003,307 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	6	35,987,271 - 35,998,212 (+)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666073	14,225,690 - 14,241,763 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Variants

Variants in Ceacam6
91 total Variants

miRNA Target Status (No longer updated)

Predicted Target Of

	Summary Value
Count of predictions:	175
Count of miRNA genes:	127
Interacting mature miRNAs:	136
Transcripts:	ENSRNOT00000034553, ENSRNOT00000057600
Prediction methods:	Microtar, Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2313059	Bss55	Bone structure and strength QTL 55	3.2	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
631688	Hcas2	Hepatocarcinoma susceptibility QTL 2	3	0.0001	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	5925874	115540829	Rat
1578649	Bmd8	Bone mineral density QTL 8	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	49393172	94393172	Rat
1582234	Gluco18	Glucose level QTL 18	3.4	0.0003	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	78479925	123479925	Rat
1358359	Sradr1	Stress Responsive Adrenal Weight QTL 1	4.74		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	30882023	123479925	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
4889929	Bss87	Bone structure and strength QTL 87	6.7		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	53895117	82174945	Rat
2313062	Bmd73	Bone mineral density QTL 73	3.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	11481312	82174945	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
1554320	Bmd1	Bone mineral density QTL 1	12.2	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	509108	86060548	Rat
2302059	Pia36	Pristane induced arthritis QTL 36	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	43333002	88333002	Rat
2313065	Bss67	Bone structure and strength QTL 67	3.1	0.0001	tibia area (VT:1000281)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
1300121	Hrtrt1	Heart rate QTL 1	3.7		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	65789093	115540829	Rat
7421628	Bp361	Blood pressure QTL 361		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	66023617	118608521	Rat
2313069	Bss68	Bone structure and strength QTL 68	2.9	0.0001	tibia size trait (VT:0100001)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
631495	Bp96	Blood pressure QTL 96	4.52		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	22340647	102268831	Rat
2313075	Bss66	Bone structure and strength QTL 66	3.4	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	11481312	82174945	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
631512	Scl6	Serum cholesterol level QTL 6	9.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	1	72197680	90508767	Rat
2298545	Neuinf8	Neuroinflammation QTL 8	4.6		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	1	57336763	151090257	Rat
2313072	Bss53	Bone structure and strength QTL 53	4.3	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	43284731	118944897	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
2313078	Bss54	Bone structure and strength QTL 54	3.5	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
2313077	Bss69	Bone structure and strength QTL 69	3.5	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	11481312	82174945	Rat
1549903	Bp267	Blood pressure QTL 267			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	77876254	106047988	Rat
2313402	Anxrr24	Anxiety related response QTL 24			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	1	48963584	144267916	Rat
61342	Bp27	Blood pressure QTL 27	3.4	0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	56732668	98773277	Rat
1300172	Bp172	Blood pressure QTL 172	3.56		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	32737273	90665040	Rat
4889962	Bss94	Bone structure and strength QTL 94	3.8		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	49361465	82174945	Rat
61344	Bp29	Blood pressure QTL 29	7.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	78350581	123350581	Rat
1358192	Ept13	Estrogen-induced pituitary tumorigenesis QTL 13	3.4		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	77494165	122494165	Rat
2313094	Bss58	Bone structure and strength QTL 58	3.7	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	43284731	118944897	Rat
6903308	Scl36	Serum cholesterol QTL 36	2	0.0125	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	53863041	90532583	Rat
2313092	Bmd72	Bone mineral density QTL 72	2.5	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	11481312	82174945	Rat
2300164	Bmd44	Bone mineral density QTL 44	5.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	1	56949932	101949932	Rat
2313099	Bss56	Bone structure and strength QTL 56	2.4	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	1	43284731	118944897	Rat
2313098	Bmd70	Bone mineral density QTL 70	3.6	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	43284731	118944897	Rat
2313097	Bss70	Bone structure and strength QTL 70	3.5	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
152025249	Scl82	Serum cholesterol level QTL 82	4.77		blood cholesterol amount (VT:0000180)		1	50343510	99980958	Rat
10054135	Gmadr2	Adrenal mass QTL 2	1.97	0.0129	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	77857876	122857876	Rat
7411712	Strs4	Sensitivity to stroke QTL 4	8.7		cerebrum integrity trait (VT:0010549)	percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)	1	78430536	123430536	Rat
4889919	Bss86	Bone structure and strength QTL 86	4.1		tibia area (VT:1000281)	tibia midshaft total cross-sectional area (CMO:0001715)	1	53895117	82174945	Rat
2313051	Bss57	Bone structure and strength QTL 57	3.7	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	43284731	118944897	Rat
61433	Cia2	Collagen induced arthritis QTL 2	5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	78430754	91209302	Rat

Markers in Region

RH134089

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	1	90,216,382 - 90,216,639 (+)	Marker Load Pipeline
mRatBN7.2	1	81,088,586 - 81,088,843 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	82,372,935 - 82,373,191	NCBI	Rnor6.0
Rnor_5.0	1	83,634,435 - 83,634,691	UniSTS	Rnor5.0
RGSC_v3.4	1	80,787,690 - 80,787,946	UniSTS	RGSC3.4
Celera	1	75,529,124 - 75,529,380	UniSTS
RH 3.4 Map	1	826.7	UniSTS

BF390792

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_5.0	1	84,319,030 - 84,319,188	NCBI	Rnor5.0
Rnor_5.0	1	83,631,977 - 83,632,135	NCBI	Rnor5.0
Rnor_5.0	1	82,958,784 - 82,958,942	NCBI	Rnor5.0
RGSC_v3.4	1	80,785,077 - 80,785,234	UniSTS	RGSC3.4
RGSC_v3.4	1	80,129,322 - 80,129,479	UniSTS	RGSC3.4
Celera	1	74,883,686 - 74,883,843	UniSTS
Celera	1	75,526,656 - 75,526,813	UniSTS
RH 3.4 Map	1	823.1	UniSTS

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

alimentary part of gastrointestinal system	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
9	5	28	21	19	8	13	8	5	45	25	18	3	24	11

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_045097	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AB434131	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC078962	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH473979	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000001	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000034553 ⟹ ENSRNOP00000034872

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	1	80,416,531 - 80,434,668 (+)	Ensembl
Rnor_6.0 Ensembl	1	81,683,500 - 81,701,230 (+)	Ensembl

Ensembl Acc Id:

ENSRNOT00000057600 ⟹ ENSRNOP00000054410

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	1	80,416,531 - 80,434,668 (+)	Ensembl
Rnor_6.0 Ensembl	1	81,683,463 - 81,701,317 (+)	Ensembl

Ensembl Acc Id:

ENSRNOT00000071029 ⟹ ENSRNOP00000066253

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0 Ensembl	1	83,043,490 - 83,061,477 (+)	Ensembl

Ensembl Acc Id:

ENSRNOT00000074720 ⟹ ENSRNOP00000064263

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0 Ensembl	1	83,043,760 - 83,049,924 (+)	Ensembl

RefSeq Acc Id:

NR_045097

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	89,544,415 - 89,562,552 (+)	NCBI
mRatBN7.2	1	80,416,531 - 80,434,668 (+)	NCBI
Rnor_6.0	1	81,683,500 - 81,701,230 (+)	NCBI
Celera	1	75,527,118 - 75,528,059 (-)	NCBI

Sequence:

show sequence

GGGGAACTGAAAACAAGCACAGGGAAGGGAGAGGAAAGAACACCGGAAGGGTAGGGAACAGGGG
CAAGTCCTAACAACAGGCCCTGTCCCTAACCCATGTGACCCTGAAAGAACCAGCCCCAGGATGA
ACTCAGCTCAGAGAGACAACAGACAACAGAACTGACCCGGCTGGACCATCAGGGCAGTGCTGGA
GCCCAAGCTCTTTTCCACAGAGAGAGGACAGAGCCAAACAACAGATCATGGAGCCCCCCTCAGC
CCATCCCCCAATGTGTGTCCCCTGGCAGGGGCTCCTGCTTGCAGCCTCACTGCTAACCATCTGG
AACTTCCCCGCCACCGCGACGCCTACTGCTGAGTCGGTGCCACCCGCAGTTCTCGAAGGGCAGA
GCGTTCTTCTTCTTGCTCACAACCTGCCAGACAACCTACTAGCCTATCACTGGTACAAGGGAAA
ACGGTCGATAGACAAAGATCTAATTATAATGTATGAAATAAAATCTCAAGAAACTAAACAAGGG
AAGCTGTACAGCGGCAAAGAGACTCTGTACCCTAATGGATCCTTGATGTTACAGAACGTCACCT
TGAAGCAATCTGGAATCTACCACCTAAATATCCATTCTGCAGATAACCAAAAGTCAGTGTTTGT
GGAAGTCTTTGTGTACCCTCTGTTAAGCAAGCCCACCATACGAAGCAACAGGACCACTGCTGTT
GAGGGCCGAGACACCGTCGAGCTGACTTGTGACCCTCTCTTCCGGAAAACAACCTACCTGTGGC
ATCTGAATGGGTCTCTAGGCATTTCAGAGGACGCTATGAATGTGAAGCCAAGAACCCACTGGGT
GCCTTCCATAGTGATCCATTCACTCTGGATGTTTTCTATGGCCCAGATACCCCCGAAATATTTC
CCCCGCACAAATACTTTGAGGAAGGCAGGAGCATGTGGCTCTCCTGCCAAGCAGTGTCTCACCC
CAAAGCACACTATTCCTGGAATGTCAATGGAGAGCCCTGGAACGCTAGACAAGAGCTGTCTATC
CACCAGGTCAGCATAAGTAATAATGGACTTTATACCTGCCTCGTCAACAACGCAGCAACTGGCC
GCAATAATTCCAAGGTCAAGGAAGTTATAATAGTGGAGAAGTTGCCAAAGCCCCACATCCAAGT
CAAAAATGAAACAGTCTTAGAACATCATTTTGTGGACCTGACCTGCATATCAGAAAACACTGGA
GTTTCCATCTGGTGGACGTTCAACAATCAGAAGCTGAAGGCCACAGACAGGATGACGTTCTCCT
GGAACAACAGAAGGCTCACCATAGACCCTGTCACAAAGGAGGATGCCGGGGCATACCAGTGTGA
GGTCTCCAACCCCCTCAACACCAGGCTGAGTGATCCAGTCAAGCTGGCTGTGCTCTATCAACCG
TCAAAAAGTCCCCTGTTGTCACCCACGATAGTGGCTAGCTTGGTTGCTGAAGTTCTGGCCGGGC
TGGCTATCCTGGGAGGCCTGGCATATTTCGTGTTTTTCAAGAAACTTGACAAGGCTTAGAACAA
AAGATTCCTTTGTATTTCTCTGTCTCCCAGTCCGGAAAGCCACGAAGGAGTACACAGGCAGGAA
CGAAAGAACTGGAAGAGAGCAAAAAGAAAGCGCAGAAAGAGCAAGAAGTAAGAGCATTCACAGT
GAGGACAAGCCAACACTGTCCACCCAAGGTCACAGGCCCCATGACAGCTATCCTCACGAGACAA
GTATTGCCTGTCTCCCCTCAGATGGCTCTGCAGGACCTGTGGACTCTTGGAACCACAACTGTGC
CATCAAGTGTGTGTCCTTAGTTCCTCATGCAACCGACAAGGAGCTTCACCTCTCCGTCCTTAGC
CTGCTCACCTACACTGCCCACTACCAAAGGGGCCAAGGGGTGTGACAACTAGCACCTATGTAGC
TCCCAGCACAGACCCAAACAAGGAAGGGACCCTTCAAAAAAAAAAAAAAAAAAAAAAAA

hide sequence

Protein Sequences


GenBank Protein	AAH78962	(Get FASTA)	NCBI Sequence Viewer
	BAG55210	(Get FASTA)	NCBI Sequence Viewer
	EDM08072	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00000034872.2
	ENSRNOP00000054410.5

Ensembl Acc Id:

ENSRNOP00000054410 ⟸ ENSRNOT00000057600

Ensembl Acc Id:

ENSRNOP00000034872 ⟸ ENSRNOT00000034553

Ensembl Acc Id:

ENSRNOP00000064263 ⟸ ENSRNOT00000074720

Ensembl Acc Id:

ENSRNOP00000066253 ⟸ ENSRNOT00000071029

Protein Domains

Ig-like Immunoglobulin V-set

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-M0R9S3-F1-model_v2	AlphaFold	M0R9S3	1-455	view protein structure
AF-F7FIX1-F1-model_v2	AlphaFold	F7FIX1	1-478	view protein structure

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:1642421	AgrOrtholog
BioCyc Gene	G2FUF-60415	BioCyc
Ensembl Genes	ENSRNOG00000030331	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
	ENSRNOG00000045673	Ensembl
Ensembl Transcript	ENSRNOT00000034553.6	UniProtKB/TrEMBL
	ENSRNOT00000057600	ENTREZGENE
	ENSRNOT00000057600.5	UniProtKB/TrEMBL
Gene3D-CATH	2.60.40.10	UniProtKB/TrEMBL
IMAGE_CLONE	IMAGE:7111028	IMAGE-MGC_LOAD
InterPro	CEA_cell_adhesion	UniProtKB/TrEMBL
	Ig-like_dom	UniProtKB/TrEMBL
	Ig-like_dom_sf	UniProtKB/TrEMBL
	Ig-like_fold	UniProtKB/TrEMBL
	Ig_sub	UniProtKB/TrEMBL
	Ig_sub2	UniProtKB/TrEMBL
	Ig_V-set	UniProtKB/TrEMBL
MGC_CLONE	MGC:93832	IMAGE-MGC_LOAD
NCBI Gene	100125369	ENTREZGENE
PANTHER	CARCINOEMBRYONIC ANTIGEN-RELATED CELL ADHESION MOLECULE 1	UniProtKB/TrEMBL
	CARCINOEMBRYONIC ANTIGEN-RELATED CELL ADHESION MOLECULE 19	UniProtKB/TrEMBL
Pfam	Ig_2	UniProtKB/TrEMBL
	Ig_3	UniProtKB/TrEMBL
	V-set	UniProtKB/TrEMBL
PhenoGen	Ceacam6	PhenoGen
PROSITE	IG_LIKE	UniProtKB/TrEMBL
RatGTEx	ENSRNOG00000030331	RatGTEx
	ENSRNOG00000045673	RatGTEx
RNAcentral	URS000075E042	RNACentral
	URS0000CD074B	RNACentral
SMART	IGc2	UniProtKB/TrEMBL
	SM00409	UniProtKB/TrEMBL
Superfamily-SCOP	SSF48726	UniProtKB/TrEMBL
UniProt	B3Y574_RAT	UniProtKB/TrEMBL
	F7EZA6_RAT	UniProtKB/TrEMBL
	Q6AYP8_RAT	UniProtKB/TrEMBL
UniProt Secondary	F7FIX1	UniProtKB/TrEMBL

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2021-03-09	Ceacam6	CEA cell adhesion molecule 6	LOC103689938	carcinoembryonic antigen-related cell adhesion molecule 1-like	Data merged from RGD:9070653	737654	PROVISIONAL
2019-09-03	Ceacam6	CEA cell adhesion molecule 6	Ceacam6	carcinoembryonic antigen-related cell adhesion molecule 6	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2014-08-25	LOC103689938	carcinoembryonic antigen-related cell adhesion molecule 1-like			Symbol and Name status set to provisional	70820	PROVISIONAL
2007-09-15	Ceacam6	carcinoembryonic antigen-related cell adhesion molecule 6			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD