Mir495 (microRNA 495) - Rat Genome Database

Name: Mir495
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir495 (microRNA 495) Mus musculus

Analyze

Symbol:

Mir495

Name:

microRNA 495

RGD ID:

1625966

MGI Page

MGI

Description:

Involved in cellular response to mechanical stimulus; cellular response to phenylalanine; and gene silencing by miRNA. Is expressed in embryo; embryo endoderm; foregut-midgut junction; liver; and pancreas. Orthologous to human MIR495 (microRNA 495).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-495; Mirn; Mirn495; mmu-mir-4; mmu-mir-495

RGD Orthologs

Human

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	12	109,685,188 - 109,685,250 (+)	NCBI	GRCm39		mm39
GRCm38	12	109,718,754 - 109,718,816 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	12	109,718,754 - 109,718,816 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	12	110,956,964 - 110,957,026 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	12	110,915,984 - 110,916,046 (+)	NCBI		Celera
Cytogenetic Map	12	F1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Experimental Neoplasms (ISO)

Kagami-Ogata syndrome (ISO)

thyroid gland papillary carcinoma (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

benzo[a]pyrene (ISO)

carboplatin (ISO)

cisplatin (ISO)

hydrogen peroxide (ISO)

methylisothiazolinone (ISO)

oxaliplatin (ISO)

phenobarbital (EXP)

progesterone (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to mechanical stimulus (IDA)

cellular response to phenylalanine (IEP)

gene silencing by miRNA (IDA)

References

Additional References at PubMed

PMID:16381832	PMID:16582102	PMID:17604727	PMID:19913497	PMID:20215419	PMID:20413612	PMID:21037258	PMID:21267068	PMID:21415270	PMID:23684747	PMID:24530979	PMID:24614228
PMID:25959411	PMID:26107383	PMID:26240138	PMID:26822703	PMID:26910393	PMID:26999812	PMID:28302484	PMID:28445809	PMID:28963864	PMID:29129493	PMID:29430619	PMID:30165354
PMID:30287499	PMID:31700003	PMID:31709454

Genomics

Comparative Map Data

Mir495
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	12	109,685,188 - 109,685,250 (+)	NCBI	GRCm39		mm39
GRCm38	12	109,718,754 - 109,718,816 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	12	109,718,754 - 109,718,816 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	12	110,956,964 - 110,957,026 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	12	110,915,984 - 110,916,046 (+)	NCBI		Celera
Cytogenetic Map	12	F1	NCBI

MIR495
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	14	101,033,755 - 101,033,836 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	14	101,033,755 - 101,033,836 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	14	101,500,092 - 101,500,173 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	14	100,569,844 - 100,569,925 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	14	81,556,148 - 81,556,229 (+)	NCBI
Cytogenetic Map	14	q32.31	NCBI
HuRef	14	81,683,582 - 81,683,663 (+)	NCBI		HuRef
CHM1_1	14	101,438,228 - 101,438,309 (+)	NCBI		CHM1_1

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4142002	Tbqt3_m	tibia bone quality traits 3 (mouse)			Not determined		12	35235497	109969809	Mouse
27226793	Feml10_m	femur length 10, 5 week (mouse)					12	68300000	113400000	Mouse
13524842	Ppiq10a_m	prepulse inhibition QTL 10a (mouse)					12	77545446	111545446	Mouse
4142401	Egq10_m	early growth QTL 10 (mouse)			Not determined			80909934	113419913	Mouse
4141335	W6q10_m	weight 6 weeks QTL 10 (mouse)			Not determined			80909934	113419913	Mouse
4141610	Tailaq1_m	tail length adjusted QTL 1 (mouse)			Not determined			80909934	113419913	Mouse
1357701	Lvrq10_m	liver weight QTL 10 (mouse)			Not determined		12	80909934	113419913	Mouse
39128213	Lwq23_m	liver weight QTL 10 (mouse)					12	80909934	113419913	Mouse
13524849	Ppiq11a_m	prepulse inhibition QTL 11a (mouse)					12	81022884	115022884	Mouse
13524846	Ppiq11_m	prepulse inhibition QTL 11 (mouse)					12	82700137	116700137	Mouse
1301879	Insq10_m	insulin QTL 10 (mouse)			Not determined		12	83565816	117565965	Mouse
1301492	Dbsty3_m	diabesity 3 (mouse)			Not determined		12	83565816	117565965	Mouse
1300883	Ath21_m	atherosclerosis 21 (mouse)			Not determined		12	85995320	119995424	Mouse
10412156	Nociq3_m	nociceptive sensitivity inflammatory QTL 3 (mouse)			Not determined		12	86349301	114868033	Mouse
4142007	Chlq17_m	circulating hormone level QTL 17 (mouse)			Not determined		12	88086615	120129022	Mouse
1300545	Lifespan3_m	life span 3 (mouse)			Not determined		12	88086615	120129022	Mouse
1301308	Prdt4_m	prion disease incubation time 4 (mouse)			Not determined		12	88342095	120129022	Mouse
5491194	Mobq3_m	multigenic obesity QTL 3 (mouse)			Not determined		12	89697812	120129022	Mouse
1301836	Heal5_m	wound healing/regeneration 5 (mouse)			Not determined		12	89972772	120129022	Mouse
1301922	Bbaa6_m	B.burgdorferi-associated arthritis 6 (mouse)			Not determined		12	90342009	120129022	Mouse
10402491	Dipa4_m	drug induced psychomotor activation 4 (mouse)			Not determined		12	91256256	120129022	Mouse
12910532	Nrq10a_m	noise-induced hearing loss resistant QTL 10a (mouse)					12	92783591	120129022	Mouse
12910533	Nrq10_m	noise-induced hearing loss resistant QTL 10 (mouse)					12	92783591	120129022	Mouse
1357463	Vtbt14_m	vertebral trabecular bone trait 14 (mouse)			Not determined		12	92969663	120129022	Mouse
1300973	Abmm_m	antibody mediated myocarditis (mouse)			Not determined		12	93298027	120129022	Mouse
1302177	Dps2_m	delta power in slow-wave sleep 2 (mouse)			Not determined		12	94179630	120129022	Mouse
1302138	Im6_m	immunoregulatory 6 (mouse)			Not determined		12	96896717	120129022	Mouse
1301269	Sluc12_m	susceptibility to lung cancer 12 (mouse)			Not determined		12	96896717	120129022	Mouse
10412075	Nils1_m	neointima lesion size 1 (mouse)			Not determined		12	102060930	120129022	Mouse
4141297	Plyid_m	Polymeric IgA dominance (mouse)			Not determined			109217459	115921502	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Bdnf	mmu-miR-495-3p	Mirtarbase	external_info	ELISA//Luciferase reporter assay//Microarray//qRT-	Functional MTI	20921386
Onecut1	mmu-miR-495-3p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR	Functional MTI	19913497
Mat1a	mmu-miR-495-3p	OncomiRDB	external_info	NA	NA	23468134
Mat1a	mmu-miR-495-3p	OncomiRDB	external_info	NA	NA	23241961
Pbx3	mmu-miR-495-3p	OncomiRDB	external_info	NA	NA	23132946
Ptp4a3	mmu-miR-495-3p	OncomiRDB	external_info	NA	NA	22469786
Fzr1	mmu-miR-495-3p	OncomiRDB	external_info	NA	NA	21258409
Onecut1	mmu-miR-495-5p	Mirecords	external_info	{changed}	NA	19913497

Predicted Targets

	Summary Value
Count of predictions:	19913
Count of gene targets:	8467
Count of transcripts:	13573
Interacting mature miRNAs:	mmu-miR-495-3p, mmu-miR-495-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_030446	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC121784	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609682	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000093597

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	12	109,718,754 - 109,718,816 (+)	Ensembl

RefSeq Acc Id:

NR_030446

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	12	109,685,188 - 109,685,250 (+)	NCBI
GRCm38	12	109,718,754 - 109,718,816 (+)	ENTREZGENE
MGSCv37	12	110,956,964 - 110,957,026 (+)	RGD
Celera	12	110,915,984 - 110,916,046 (+)	RGD
cM Map	12		ENTREZGENE

Sequence:

show sequence

AAAGAAGTTGCCCATGTTATTTTTCGCTTTTATTTGTGACGAAACAAACATGGTGCACTTCTT

hide sequence

Promoters

RGD ID:

8679260

Promoter ID:

EPDNEW_M17661

Type:

single initiation site

Name:

Mir495_1

Description:

Mus musculus microRNA 495 , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	12	109,718,821 - 109,718,881	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3629903	AgrOrtholog
Ensembl Genes	ENSMUSG00000070105	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000093597	ENTREZGENE
MGD	MGI:3629903	ENTREZGENE
miRBase	MI0004639	ENTREZGENE
NCBI Gene	751522	ENTREZGENE
PhenoGen	Mir495	PhenoGen
RNAcentral	URS000005A8ED	RNACentral
	URS00003E76AD	RNACentral
	URS000075E0AD	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD