Mir496a (microRNA 496a) - Rat Genome Database

Name: Mir496a
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir496a (microRNA 496a) Mus musculus

Analyze

Symbol:

Mir496a

Name:

microRNA 496a

RGD ID:

1625964

MGI Page

MGI

Description:

Involved in cellular response to ethanol and cellular response to phenylalanine. Orthologous to human MIR496 (microRNA 496).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-496a; Mir496; Mirn; Mirn496; mmu-mir-4; mmu-mir-496; mmu-mir-496a

RGD Orthologs

Human

Rat

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	12	109,705,553 - 109,705,631 (+)	NCBI	GRCm39		mm39
GRCm38	12	109,739,119 - 109,739,197 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	12	109,739,119 - 109,739,197 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	12	110,977,329 - 110,977,407 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	12	110,936,349 - 110,936,427 (+)	NCBI		Celera
Cytogenetic Map	12	F1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Kagami-Ogata syndrome (ISO)

thyroid gland papillary carcinoma (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

2-hydroxypropanoic acid (ISO)

3-chloropropane-1,2-diol (EXP)

benzo[a]pyrene (ISO)

cadmium atom (EXP)

cadmium dichloride (EXP)

catechol (EXP)

chloroform (EXP)

ethanol (EXP)

phenobarbital (EXP)

rac-lactic acid (ISO)

sodium fluoride (EXP)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to ethanol (IEP)

cellular response to phenylalanine (IEP)

References

References - curated


1.	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
2.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16381832	PMID:16582102	PMID:19091803	PMID:20215419	PMID:20413612	PMID:21037258	PMID:21267068	PMID:21822254	PMID:22144232	PMID:24614228	PMID:26822703

Genomics

Comparative Map Data

Mir496a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	12	109,705,553 - 109,705,631 (+)	NCBI	GRCm39		mm39
GRCm38	12	109,739,119 - 109,739,197 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	12	109,739,119 - 109,739,197 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	12	110,977,329 - 110,977,407 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	12	110,936,349 - 110,936,427 (+)	NCBI		Celera
Cytogenetic Map	12	F1	NCBI

MIR496
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	14	101,060,573 - 101,060,674 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	14	101,060,573 - 101,060,674 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	14	101,526,910 - 101,527,011 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	14	100,596,662 - 100,596,763 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	14	81,582,971 - 81,583,072 (+)	NCBI
Cytogenetic Map	14	q32.31	NCBI
HuRef	14	81,710,283 - 81,710,384 (+)	NCBI		HuRef
CHM1_1	14	101,465,932 - 101,466,033 (+)	NCBI		CHM1_1

Mir496
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	6	128,753,644 - 128,753,722 (+)	NCBI
Rnor_6.0 Ensembl	6	133,889,283 - 133,889,361 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	6	133,889,283 - 133,889,361 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	6	143,051,640 - 143,051,718 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	6	126,338,023 - 126,338,101 (+)	NCBI		Celera
Cytogenetic Map	6	q32	NCBI

MIR496
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	8	69,289,410 - 69,289,507 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	8	69,289,410 - 69,289,507 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4142002	Tbqt3_m	tibia bone quality traits 3 (mouse)			Not determined		12	35235497	109969809	Mouse
27226793	Feml10_m	femur length 10, 5 week (mouse)					12	68300000	113400000	Mouse
13524842	Ppiq10a_m	prepulse inhibition QTL 10a (mouse)					12	77545446	111545446	Mouse
4142401	Egq10_m	early growth QTL 10 (mouse)			Not determined			80909934	113419913	Mouse
4141335	W6q10_m	weight 6 weeks QTL 10 (mouse)			Not determined			80909934	113419913	Mouse
4141610	Tailaq1_m	tail length adjusted QTL 1 (mouse)			Not determined			80909934	113419913	Mouse
1357701	Lvrq10_m	liver weight QTL 10 (mouse)			Not determined		12	80909934	113419913	Mouse
39128213	Lwq23_m	liver weight QTL 10 (mouse)					12	80909934	113419913	Mouse
13524849	Ppiq11a_m	prepulse inhibition QTL 11a (mouse)					12	81022884	115022884	Mouse
13524846	Ppiq11_m	prepulse inhibition QTL 11 (mouse)					12	82700137	116700137	Mouse
1301879	Insq10_m	insulin QTL 10 (mouse)			Not determined		12	83565816	117565965	Mouse
1301492	Dbsty3_m	diabesity 3 (mouse)			Not determined		12	83565816	117565965	Mouse
1300883	Ath21_m	atherosclerosis 21 (mouse)			Not determined		12	85995320	119995424	Mouse
10412156	Nociq3_m	nociceptive sensitivity inflammatory QTL 3 (mouse)			Not determined		12	86349301	114868033	Mouse
4142007	Chlq17_m	circulating hormone level QTL 17 (mouse)			Not determined		12	88086615	120129022	Mouse
1300545	Lifespan3_m	life span 3 (mouse)			Not determined		12	88086615	120129022	Mouse
1301308	Prdt4_m	prion disease incubation time 4 (mouse)			Not determined		12	88342095	120129022	Mouse
5491194	Mobq3_m	multigenic obesity QTL 3 (mouse)			Not determined		12	89697812	120129022	Mouse
1301836	Heal5_m	wound healing/regeneration 5 (mouse)			Not determined		12	89972772	120129022	Mouse
1301922	Bbaa6_m	B.burgdorferi-associated arthritis 6 (mouse)			Not determined		12	90342009	120129022	Mouse
10402491	Dipa4_m	drug induced psychomotor activation 4 (mouse)			Not determined		12	91256256	120129022	Mouse
12910532	Nrq10a_m	noise-induced hearing loss resistant QTL 10a (mouse)					12	92783591	120129022	Mouse
12910533	Nrq10_m	noise-induced hearing loss resistant QTL 10 (mouse)					12	92783591	120129022	Mouse
1357463	Vtbt14_m	vertebral trabecular bone trait 14 (mouse)			Not determined		12	92969663	120129022	Mouse
1300973	Abmm_m	antibody mediated myocarditis (mouse)			Not determined		12	93298027	120129022	Mouse
1302177	Dps2_m	delta power in slow-wave sleep 2 (mouse)			Not determined		12	94179630	120129022	Mouse
1302138	Im6_m	immunoregulatory 6 (mouse)			Not determined		12	96896717	120129022	Mouse
1301269	Sluc12_m	susceptibility to lung cancer 12 (mouse)			Not determined		12	96896717	120129022	Mouse
10412075	Nils1_m	neointima lesion size 1 (mouse)			Not determined		12	102060930	120129022	Mouse
4141297	Plyid_m	Polymeric IgA dominance (mouse)			Not determined			109217459	115921502	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	15867
Count of gene targets:	8211
Count of transcripts:	13005
Interacting mature miRNAs:	mmu-miR-496a-3p, mmu-miR-496a-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_030437	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC121784	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609672	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000093627

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	12	109,739,119 - 109,739,197 (+)	Ensembl

RefSeq Acc Id:

NR_030437

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	12	109,705,553 - 109,705,631 (+)	NCBI
GRCm38	12	109,739,119 - 109,739,197 (+)	ENTREZGENE
MGSCv37	12	110,977,329 - 110,977,407 (+)	RGD
Celera	12	110,936,349 - 110,936,427 (+)	RGD
cM Map	12		ENTREZGENE

Sequence:

show sequence

AGTGTTCGAATGGAGGTTGCCCATGGTGTGTTCATTTTATTTATGATGAGTATTACATGGCCAA
TCTCCTTTCGGCACT

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3629907	AgrOrtholog
Ensembl Genes	ENSMUSG00000070136	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000093627	ENTREZGENE
MGD	MGI:3629907	ENTREZGENE
miRBase	MI0004589	ENTREZGENE
NCBI Gene	751524	ENTREZGENE
PhenoGen	Mir496a	PhenoGen
RNAcentral	URS000003BF62	RNACentral
	URS00000CE959	RNACentral
	URS000066E3E2	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2014-05-27	Mir496a	microRNA 496a	Mir496	microRNA 496	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD