Snora62 (small nucleolar RNA, H/ACA box 62)

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Snora62 (small nucleolar RNA, H/ACA box 62) Mus musculus

Analyze

Symbol:

Snora62

Name:

small nucleolar RNA, H/ACA box 62

RGD ID:

1620677

MGI Page

MGI

Description:

Predicted to localize to small nucleolar ribonucleoprotein complex. Orthologous to human SNORA62 (small nucleolar RNA, H/ACA box 62); INTERACTS WITH fluoranthene; butanal (ortholog); N-methyl-N'-nitro-N-nitrosoguanidine (ortholog).

Type:

snorna

RefSeq Status:

VALIDATED

Also known as:

E2; MBI-13; MBI-136; Rnu1; Rnu108

RGD Orthologs

Human

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	119,959,500 - 119,959,629 (+)	NCBI	GRCm39		mm39
GRCm38	9	120,130,434 - 120,130,563 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	120,130,415 - 120,130,563 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	120,039,552 - 120,039,681 (+)	NCBI	GRCm37		mm9	NCBIm37
MGSCv36	9	119,979,132 - 119,979,261 (+)	NCBI			mm8
Celera	9	120,599,245 - 120,599,374 (+)	NCBI		Celera
Cytogenetic Map	9	F4	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

butanal (ISO)

fluoranthene (EXP)

N-methyl-N'-nitro-N-nitrosoguanidine (ISO)

propanal (ISO)

sunitinib (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

biological_process (ND)

Cellular Component

sno(s)RNA-containing ribonucleoprotein complex (ISO)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:9092667	PMID:11387227

Genomics

Comparative Map Data

Snora62
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	119,959,500 - 119,959,629 (+)	NCBI	GRCm39		mm39
GRCm38	9	120,130,434 - 120,130,563 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	120,130,415 - 120,130,563 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	120,039,552 - 120,039,681 (+)	NCBI	GRCm37		mm9	NCBIm37
MGSCv36	9	119,979,132 - 119,979,261 (+)	NCBI			mm8
Celera	9	120,599,245 - 120,599,374 (+)	NCBI		Celera
Cytogenetic Map	9	F4	NCBI

SNORA62
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	3	39,411,054 - 39,411,206 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	3	39,411,054 - 39,411,207 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	3	39,452,545 - 39,452,698 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	3	39,427,549 - 39,427,702 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	3	39,394,155 - 39,394,308 (+)	NCBI
Cytogenetic Map	3	p22.1	NCBI
HuRef	3	39,495,885 - 39,496,038 (+)	NCBI		HuRef
CHM1_1	3	39,403,596 - 39,403,749 (+)	NCBI		CHM1_1

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4141833	W10q13_m	weight 10 weeks QTL 13 (mouse)			Not determined			63332429	120362868	Mouse
4141545	Tailaq2_m	tail length adjusted QTL 2 (mouse)			Not determined			63332429	120362868	Mouse
1357635	Splq4_m	spleen weight QTL 4 (mouse)			Not determined		9	63332429	120362868	Mouse
1300549	Bbaa17_m	B. burgdorferi-associated arthritis 17 (mouse)			Not determined		9	86230401	120230530	Mouse
1302103	Dob2_m	dietary obesity 2 (mouse)			Not determined		9	86239845	120289624	Mouse
11251716	Siim2_m	stress induced immobility 2 (mouse)					9	86748483	120748483	Mouse
12880422	V25Dq6_m	vitamin D inactive form serum level QTL 6 (mouse)					9	87800000	121800000	Mouse
10412242	Alpq8_m	alcohol preference QTL 8 (mouse)			Not determined		9	89284925	123284925	Mouse
1301649	Psl1_m	promotion susceptibility QTL 1 (mouse)			Not determined		9	89412277	123412396	Mouse
18182932	Metl3_m	metabolite locus 3, N-acetylglutamate (mouse)					9	89563342	123563342	Mouse
12910770	Splic1_m	spleen iron content 1 (mouse)					9	91413879	124595110	Mouse
12910772	Lvic6_m	liver iron content 6 (mouse)					9	91413879	124595110	Mouse
12910773	Splic3_m	spleen iron content 3 (mouse)					9	91413879	124595110	Mouse
1558767	Skmw11_m	skeletal muscle weight 11 (mouse)			Not determined		9	91641084	124595110	Mouse
13463474	Hbbcq5_m	hemoglobin concentration QTL 5 (mouse)					9	91641084	124595110	Mouse
13463475	Hctq7_m	hematocrit QTL 7 (mouse)					9	91641084	124595110	Mouse
13463477	Rbc9_m	red blood cell count 9 (mouse)					9	91641084	124595110	Mouse
13463478	Mchq18_m	mean corpuscular hemoglobin QTL 18 (mouse)					9	91641084	124595110	Mouse
13463480	Mchcq2_m	mean corpuscular hemoglobin concentration QTL 2 (mouse)					9	91641084	124595110	Mouse
12904937	Edlmmq9_m	extensor digitorum longus muscle mass QTL 9 (mouse)					9	91683173	124595110	Mouse
12904947	Tammq7_m	tibialis anterior muscle mass QTL 7 (mouse)					9	91683173	124595110	Mouse
12904961	Gmmq7_m	gastrocnemius muscle mass QTL 7 (mouse)					9	91683173	124595110	Mouse
1302001	Bdln5_m	body length 5 (mouse)			Not determined		9	93762590	124595110	Mouse
1301484	Bwq6_m	body weight (mouse)			Not determined		9	93762590	124595110	Mouse
14746992	Manh67_m	mandible shape 67 (mouse)					9	94036768	124595110	Mouse
11537364	Cnes5_m	C. neoformans susceptibility locus 5 (mouse)					9	96917590	124595110	Mouse
1301297	Lcho1_m	liver cholesterol 1 (mouse)			Not determined		9	101060861	124595110	Mouse
1357627	Tgq2_m	triglyceride QTL 2 (mouse)			Not determined		9	102000187	124595110	Mouse
1357648	Obq18_m	obesity QTL 18 (mouse)			Not determined		9	102000187	124595110	Mouse
1301789	Pbwg4_m	postnatal body weight growth 4 (mouse)			Not determined		9	103289445	124595110	Mouse
10412290	Pvacm1l_m	plasma vascular cell adhesion molecule 1 levels (mouse)			Not determined		9	103289445	124595110	Mouse
12879896	Berr3_m	berghei resistance locus 3 (mouse)					9	103289445	124595110	Mouse

miRNA Target Status

Predicted Target Of

	Summary Value
Count of predictions:	140
Count of miRNA genes:	134
Interacting mature miRNAs:	138
Transcripts:	ENSMUST00000082991
Prediction methods:	Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_002902	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC110091	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AF357422	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DQ360291	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DQ360292	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	U64703	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000082991

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	9	120,130,415 - 120,130,563 (+)	Ensembl

RefSeq Acc Id:

NR_002902

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	9	119,959,500 - 119,959,629 (+)	NCBI
GRCm38	9	120,130,434 - 120,130,563 (+)	ENTREZGENE
MGSCv37	9	120,039,552 - 120,039,681 (+)	RGD
Celera	9	120,599,245 - 120,599,374 (+)	RGD
cM Map	9		ENTREZGENE

Sequence:

show sequence

TGGAGTTGAGGTCACACGCTGGTCGATGAACTCACAAGTGTAGGTAGTGTGCTAAAAGAGTGGC
AAGGTTTTCGCTAACACCCCACTCTGGTCCAGTGAGTGGGGTTTGATAGTAACCTTTGCTACAA
AA

hide sequence

Promoters

RGD ID:

6845188

Promoter ID:

MM_KWN:59164

Type:

Non-CpG

SO ACC ID:

SO:0000170

Source:

MPROMDB

Tissues & Cell Lines:

3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, BoneMarrow_0Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6

Transcripts:

NR_002902, UC009SCH.1

Position:

Mouse Assembly	Chr	Position (strand)	Source
MGSCv36	9	120,038,686 - 120,040,157 (+)	MPROMDB

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2148179	AgrOrtholog
Ensembl Genes	ENSMUSG00000064925	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000082991	ENTREZGENE
MGD	MGI:2148179	ENTREZGENE
NCBI Gene	104433	ENTREZGENE
PhenoGen	Snora62	PhenoGen
RNAcentral	URS000075EA33	RNACentral
UniGene	Mm.453530	ENTREZGENE

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)