Gene: 1810044D09Rik (RIKEN cDNA 1810044D09 gene) Mus musculus |
|
 Analyze |
|
Symbol: |
1810044D09Rik |
Name: |
RIKEN cDNA 1810044D09 gene |
RGD ID: |
1609825 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna
|
RefSeq Status: |
VALIDATED |
Also known as: |
hypothetical protein LOC69798 |
Latest Assembly: |
GRCm38 - Mouse Genome Assembly GRCm38 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 6 | 91,417,969 - 91,418,737 (+) | NCBI | GRCm39 | | mm39 | | GRCm38 | 6 | 91,440,987 - 91,441,755 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 6 | 91,440,987 - 91,441,755 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 6 | 91,390,981 - 91,391,749 (+) | NCBI | GRCm37 | | mm9 | NCBIm37 | Celera | 6 | 93,333,648 - 93,334,416 (+) | NCBI | | Celera | | | Cytogenetic Map | 6 | D1 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Additional References at PubMed
Genomics
Position Markers
UniSTS:235498 |
Mouse Assembly | Chr | Position (strand) | Source | JBrowse |
---|
GRCm38 | 6 | 91,440,525 - 91,440,833 | UniSTS | GRCm38 | MGSCv37 | 6 | 91,390,519 - 91,390,827 | UniSTS | GRCm37 | Celera | 6 | 93,333,186 - 93,333,494 | UniSTS | | Cytogenetic Map | 6 | D1 | UniSTS | |
|
UniSTS:235499 |
Mouse Assembly | Chr | Position (strand) | Source | JBrowse |
---|
GRCm38 | 6 | 91,441,467 - 91,441,711 | UniSTS | GRCm38 | MGSCv37 | 6 | 91,391,461 - 91,391,705 | UniSTS | GRCm37 | Celera | 6 | 93,334,128 - 93,334,372 | UniSTS | | Cytogenetic Map | 6 | D1 | UniSTS | |
|
QTLs in Region (GRCm38)
25440480 | Moaq2_m | modifier of alien QTL 2 (mouse) | | | | | 6 | 1 | 117500000 | Mouse | 26884414 | Bzwq12_m | bi-zygomatic width QTL 12, 16 week (mouse) | | | | | 6 | 3400000 | 139100000 | Mouse | 4142126 | W3q3_m | weight 3 weeks QTL 3 (mouse) | | | Not determined | | | 4503823 | 96656149 | Mouse | 4142361 | W10q11_m | weight 10 weeks QTL 11 (mouse) | | | Not determined | | | 4503823 | 96656149 | Mouse | 4142271 | Egq8_m | early growth QTL 8 (mouse) | | | Not determined | | | 4503823 | 96656149 | Mouse | 4142232 | W6q4_m | weight 6 weeks QTL 4 (mouse) | | | Not determined | | | 4503823 | 96656149 | Mouse | 1558984 | Cplaq9_m | circadian period of locomotor activity 9 (mouse) | | | Not determined | | 6 | 38669625 | 92607450 | Mouse | 10412157 | Fl1n_m | fatty liver 1 in NSY (mouse) | | | Not determined | | 6 | 45314059 | 128835032 | Mouse | 4142259 | Tabw2_m | tally ho associated body weight 2 (mouse) | | | Not determined | | | 46935985 | 136423692 | Mouse | 25314319 | Histh6_m | histamine hypersensitivity 6 (mouse) | | | | | 6 | 48720000 | 125360000 | Mouse | 25314320 | Histh5_m | histamine hypersensitivity 5 (mouse) | | | | | 6 | 48720000 | 148450000 | Mouse | 1301962 | Eila2_m | ethanol induced locomotor activity 2 (mouse) | | | Not determined | | 6 | 48726556 | 125356785 | Mouse | 1357683 | Igf1sl1_m | IGF-1 serum levels 1 (mouse) | | | Not determined | | 6 | 52161713 | 116155267 | Mouse | 1558977 | Skmw10_m | skeletal muscle weight 10 (mouse) | | | Not determined | | 6 | 58447583 | 92447710 | Mouse | 10043972 | Obq28_m | obesity QTL 28 (mouse) | | | Not determined | | 6 | 58540433 | 92540433 | Mouse | 1301740 | Bwq2_m | body weight QTL 2 (mouse) | | | Not determined | | 6 | 60057680 | 94057799 | Mouse | 1301369 | Im4_m | immunoregulatory 4 (mouse) | | | Not determined | | 6 | 63484738 | 97484905 | Mouse | 1300650 | Bw18_m | body weight QTL 18 (mouse) | | | Not determined | | 6 | 66713869 | 100714031 | Mouse | 1301876 | Bits2_m | bitterness sensitivity 2 (mouse) | | | Not determined | | 6 | 70425898 | 104426034 | Mouse | 1301813 | Skl3_m | skeletal size (tail length) 3 (mouse) | | | Not determined | | 6 | 70425898 | 104426034 | Mouse | 1301034 | Egrm2_m | early growth rate (mouse) | | | Not determined | | 6 | 70425898 | 104426034 | Mouse | 1302020 | Bbaa20_m | B.burgdorferi-associated arthritis 20 (mouse) | | | Not determined | | 6 | 71322621 | 93464093 | Mouse | 1300869 | Stheal5_m | soft tissue heal 5 (mouse) | | | Not determined | | 6 | 71575060 | 105575178 | Mouse | 1300954 | Fcsa1_m | femoral cross-sectional area 1 (mouse) | | | Not determined | | 6 | 71981024 | 105981170 | Mouse | 1301521 | Pas1c_m | pulmonary adenoma susceptibility 1c (mouse) | | | Not determined | | 6 | 71981024 | 105981170 | Mouse | 13506930 | Recrq9_m | recombination rate in male meiosis QTL 9 (mouse) | | | | | 6 | 73500000 | 134700000 | Mouse | 1301320 | Ots1_m | ovarian teratoma susceptibility 1 (mouse) | | | Not determined | | 6 | 75447583 | 104503555 | Mouse | 1301571 | Arrd1_m | age-related retinal degeneration 1 (mouse) | | | Not determined | | 6 | 75544356 | 92607450 | Mouse | 1300674 | Nidd3n_m | non-insulin-dependent diabetes mellitus 3 in NSY (mouse) | | | Not determined | | 6 | 75544356 | 94225955 | Mouse | 10412195 | Efw_m | epididymal fat weight (mouse) | | | Not determined | | 6 | 75544356 | 94225955 | Mouse | 10043901 | Pfat5_m | predicted fat percentage 5 (mouse) | | | Not determined | | 6 | 75607306 | 109607450 | Mouse | 10412208 | Cypr4_m | cytokine production 4 (mouse) | | | Not determined | | 6 | 75716503 | 109716697 | Mouse | 1357875 | Pfat2_m | predicted fat percentage 2 (mouse) | | | Not determined | | 6 | 76463949 | 110464093 | Mouse | 13824985 | Alh1_m | amplitude of lateral head displacement 1 (mouse) | | | | | 6 | 78000000 | 97000000 | Mouse | 4141376 | Dbm1_m | diabetes modifier 1 (mouse) | | | Not determined | | 6 | 78629504 | 121115387 | Mouse | 14696731 | Pairq1_m | P. aeruginosa infection resistance QTL 1 (mouse) | | | | | 6 | 81500000 | 102200000 | Mouse | 10043864 | T2dm4sa_m | type 2 diabetes mellitus 4 in SMXA RI mice (mouse) | | | Not determined | | 6 | 83713869 | 147052561 | Mouse | 11251720 | Ewc4_m | ethanol withdrawal and consumption 4 (mouse) | | | | | 6 | 84122513 | 118122513 | Mouse | 1301687 | Mnic2_m | macronutrient intake (mouse) | | | Not determined | | 6 | 86806805 | 113544602 | Mouse | 1301744 | Hdlq11_m | HDL QTL 11 (mouse) | | | Not determined | | 6 | 87503360 | 121503555 | Mouse | 1301262 | Gasa3_m | gastritis type A susceptibility locus 3 (mouse) | | | Not determined | | 6 | 89005405 | 123005603 | Mouse | 1301244 | Ichs_m | immediate cutaneous hypersensitivity QTL (mouse) | | | Not determined | | 6 | 90795610 | 124795846 | Mouse | |
Expression
Sequence
Reference Sequences
RefSeq Acc Id: |
ENSMUST00000186472 |
RefSeq Status: |
|
Type: |
CODING
|
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38.p6 Ensembl | 6 | 91,440,987 - 91,441,755 (+) | Ensembl |
|
RefSeq Acc Id: |
NR_038153 |
RefSeq Status: |
VALIDATED
|
Type: |
NON-CODING
|
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 6 | 91,417,969 - 91,418,737 (+) | NCBI | GRCm38 | 6 | 91,440,987 - 91,441,755 (+) | ENTREZGENE | Celera | 6 | 93,333,648 - 93,334,416 (+) | ENTREZGENE | cM Map | 6 | | ENTREZGENE |
|
Sequence: |
TTTCCTTGCCTTGGTCCCTGAGAACCGTCTTCCGACCCTTCCTCCTTCGGTGCTGACTGCTCCC GCGGCTCTTTACGCTGAGATGTTTCACTGACTTCTGCCTGAGATCTGGAAAAGGAACACTGCCC AATAGATGAACATGTGTGAAAAATAACTTCCAAGGAACATCATGTGCGCAGGGACTGTGCTAAA CAGAAAACTGTCAGTCACTGCGGGAATGTGCCTCCCTGATCGCCGCGATCGCCCGCTGCCGCAG CTGTTTCTCCTTCACACGCATAGGCTCCCTGTCTTGCATGGGAGGGAGCAGACCCAGGGGACAC CAGACCAACTTGAGTTCACATGGGTTGACTATCCACACCTCTCTCCTCTGTCTTTGGTATCCCG TGAAGTGTGCTGTGTCTCCTCTACCCTGTGATTCCTGTTCATCTCAGGAAGCAGCTGAAAGGGT CAGGAAGGTCCTGGGACATTAAACTACTGTTTGGATGAAAAAAAAAAAAAAA
hide sequence
|
Promoters
RGD ID: | 6890450 |
Promoter ID: | EPDNEW_M8674 |
Type: | initiation region |
Name: | 1810044D09Rik_1 |
Description: | Mus musculus RIKEN cDNA 1810044D09 gene , long non-coding RNA. |
SO ACC ID: | SO:0000170 |
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 6 | 91,441,015 - 91,441,075 | EPDNEW |
|
RGD ID: | 15093123 |
Promoter ID: | EPDNEWNC_M1034 |
Type: | initiation region |
Name: | 1810044D09Rik_1 |
Description: | RIKEN cDNA 1810044D09 gene [Source:MGISymbol;Acc:MGI:1917048] |
SO ACC ID: | SO:0000170 |
Source: | EPDNEWNC (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 6 | 91,441,015 - 91,441,075 | EPDNEWNC |
|
Additional Information
|
|