Mir132 (microRNA 132) - Rat Genome Database

Name: Mir132
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir132 (microRNA 132) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir132

Name:

microRNA 132

Description:

Involved in several processes, including cellular response to forskolin; long-term synaptic potentiation; and regulation of neuron differentiation. Localizes to the postsynaptic density. Is expressed in cerebellum; embryo; lung; and telencephalon.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-132; Mirn132; mmu-mir-132

Orthologs:

Homo sapiens (human) : MIR132 (microRNA 132) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir132 (microRNA 132) Alliance
Canis lupus familiaris (dog) : MIR132 (microRNA mir-132)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR132 (microRNA 132)	HGNC	Ensembl
Rattus norvegicus (Norway rat):	Mir132 (microRNA 132)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR132 (microRNA mir-132)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Danio rerio (zebrafish):	mir132-1 (microRNA 132-1)	Alliance	DIOPT (ZFIN)

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	11	75,173,682 - 75,173,747 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	11	74,987,184 - 74,987,249 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	11	82,680,626 - 82,680,691 (+)	NCBI		Celera
Cytogenetic Map	11	B5	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

RGD Manual Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Huntington's disease		IEP		11041745	down-regulated	RGD
Parkinson's disease		ISO	RGD:1346883	10450788		RGD

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Brain Injuries		ISO	RGD:1346883	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23159883
Breast Neoplasms		ISO	RGD:1346883	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:20099276
Chemical and Drug Induced Liver Injury		ISO	RGD:1346883	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22363424

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
(-)-citrinin	multiple interactions	ISO	RGD:1346883	6480464	[Citrinin co-treated with ochratoxin A] results in increased expression of MIR132 mRNA	CTD	PMID:30428381
2-acetamidofluorene	increases expression	ISO	RGD:2325572	6480464	2-Acetylaminofluorene results in increased expression of MIR132 mRNA	CTD	PMID:19167416
3-chloropropane-1,2-diol	increases expression	EXP		6480464	alpha-Chlorohydrin analog results in increased expression of MIR132 mRNA	CTD	PMID:29860048
aflatoxin B1	increases expression	ISO	RGD:2325572	6480464	Aflatoxin B1 results in increased expression of MIR132 mRNA	CTD	PMID:24472605
all-trans-retinoic acid	increases expression	ISO	RGD:1346883	6480464	Tretinoin results in increased expression of MIR132 mRNA	CTD	PMID:23903816
arsenous acid	increases expression	ISO	RGD:1346883	6480464	Arsenic Trioxide results in increased expression of MIR132 mRNA	CTD	PMID:22072212
bis(2-ethylhexyl) phthalate	affects expression	ISO	RGD:2325572	6480464	Diethylhexyl Phthalate affects the expression of MIR132 mRNA	CTD	PMID:28192093
chlorpyrifos	increases expression	ISO	RGD:2325572	6480464	Chlorpyrifos results in increased expression of MIR132 mRNA	CTD	PMID:26775027
cisplatin	affects response to substance	ISO	RGD:1346883	6480464	MIR132 promoter affects the susceptibility to Cisplatin	CTD	PMID:20099276
cocaine	increases expression	ISO	RGD:2325572	6480464	Cocaine results in increased expression of MIR132 protein	CTD	PMID:20711185
cocaine	multiple interactions	ISO	RGD:1346883	6480464	MECP2 mRNA inhibits the reaction [Cocaine results in increased expression of MIR132 protein]	CTD	PMID:20711185
diarsenic trioxide	increases expression	ISO	RGD:1346883	6480464	Arsenic Trioxide results in increased expression of MIR132 mRNA	CTD	PMID:22072212
hexanal	increases expression	ISO	RGD:2325572	6480464	n-hexanal results in increased expression of MIR132 mRNA	CTD	PMID:26403475
hydrogen peroxide	increases expression	ISO	RGD:1346883	6480464	Hydrogen Peroxide results in increased expression of MIR132 mRNA	CTD	PMID:26339600
LY294002	multiple interactions	ISO	RGD:2325572	6480464	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [INS1 protein results in increased expression of MIR132 mRNA]	CTD	PMID:23920219
monocrotaline	decreases expression	EXP		6480464	Monocrotaline results in decreased expression of MIR132 mRNA	CTD	PMID:28818515
morphine	increases expression	ISO	RGD:1346883	6480464	Morphine results in increased expression of MIR132	CTD	PMID:20564181
nitrofen	increases expression	ISO	RGD:2325572	6480464	nitrofen results in increased expression of MIR132 mRNA	CTD	PMID:26720608
ochratoxin A	increases expression	ISO	RGD:1346883	6480464	ochratoxin A results in increased expression of MIR132 mRNA	CTD	PMID:30428381, PMID:30559759
ochratoxin A	multiple interactions	ISO	RGD:1346883	6480464	[Citrinin co-treated with ochratoxin A] results in increased expression of MIR132 mRNA	CTD	PMID:30428381
ozone	increases expression	ISO	RGD:1346883	6480464	Ozone results in increased expression of MIR132 mRNA	CTD	PMID:24771714
paracetamol	decreases expression	ISO	RGD:2325572	6480464	Acetaminophen results in decreased expression of MIR132 mRNA	CTD	PMID:22363424, PMID:27397436
quercetin	increases expression	ISO	RGD:2325572	6480464	Quercetin results in increased expression of MIR132 mRNA	CTD	PMID:26432773
silver atom	increases expression	ISO	RGD:1346883	6480464	Silver results in increased expression of MIR132 mRNA	CTD	PMID:26551752
silver(0)	increases expression	ISO	RGD:1346883	6480464	Silver results in increased expression of MIR132 mRNA	CTD	PMID:26551752
sirolimus	multiple interactions	ISO	RGD:2325572	6480464	Sirolimus inhibits the reaction [INS1 protein results in increased expression of MIR132 mRNA]	CTD	PMID:23920219
sodium arsenite	increases expression	EXP		6480464	sodium arsenite results in increased expression of MIR132 mRNA	CTD	PMID:24896083
sodium fluoride	increases expression	EXP		6480464	Sodium Fluoride results in increased expression of MIR132 mRNA	CTD	PMID:29127033
Sporidesmin	increases expression	ISO	RGD:1346883	6480464	sporidesmin results in increased expression of MIR132 mRNA	CTD	PMID:28193462
streptozocin	increases expression	EXP		6480464	Streptozocin results in increased expression of MIR132 mRNA	CTD	PMID:27629361
zinc atom	decreases expression	ISO	RGD:2325572	6480464	Zinc deficiency results in decreased expression of MIR132 mRNA	CTD	PMID:22689922
zinc(0)	decreases expression	ISO	RGD:2325572	6480464	Zinc deficiency results in decreased expression of MIR132 mRNA	CTD	PMID:22689922

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cell aging		IDA		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
cellular response to forskolin		IEP		2290270	(MGI:MGI:5305371, PMID:21993888)	MGI	MGI:MGI:5305371, PMID:21993888
cellular response to inorganic substance		IDA		2290270	(MGI:MGI:5305371, PMID:21993888)	MGI	MGI:MGI:5305371, PMID:21993888
long-term synaptic potentiation		IEP		2290270	(MGI:MGI:5645435, PMID:25858512)	MGI	MGI:MGI:5645435, PMID:25858512
regulation of dendrite development		IGI	MGI:MGI:2676888	2290270	(MGI:MGI:4848233, PMID:21059906)	MGI	MGI:MGI:4848233, PMID:21059906
regulation of neuron maturation		IGI	MGI:MGI:2676888	2290270	(MGI:MGI:4848233, PMID:21059906)	MGI	MGI:MGI:4848233, PMID:21059906
response to oxygen levels		IDA		2290270	(MGI:MGI:3807359, PMID:18723672)	MGI	MGI:MGI:3807359, PMID:18723672

Cellular Component

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
postsynaptic density		IDA		2290270	(MGI:MGI:5449129, PMID:22897173)	MGI	MGI:MGI:5449129, PMID:22897173

Molecular Pathway Annotations

RGD Manual Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Huntington's disease pathway		IEP		11041745	down-regulated	RGD
Parkinson's disease pathway		ISO	RGD:1346883	10450788		RGD

Disease Annotations

	Brain Injuries (ISO)
	Breast Neoplasms (ISO)

	Chemical and Drug Induced Liver Injury (ISO)
	Huntington's disease (IEP)

Parkinson's disease (ISO)

Gene-Chemical Interaction Annotations

	(-)-citrinin (ISO)
	2-acetamidofluorene (ISO)
	3-chloropropane-1,2-diol (EXP)
	aflatoxin B1 (ISO)
	all-trans-retinoic acid (ISO)
	arsenous acid (ISO)
	bis(2-ethylhexyl) phthalate (ISO)
	chlorpyrifos (ISO)
	cisplatin (ISO)
	cocaine (ISO)
	diarsenic trioxide (ISO)

	hexanal (ISO)
	hydrogen peroxide (ISO)
	LY294002 (ISO)
	monocrotaline (EXP)
	morphine (ISO)
	nitrofen (ISO)
	ochratoxin A (ISO)
	ozone (ISO)
	paracetamol (ISO)
	quercetin (ISO)
	silver atom (ISO)

	silver(0) (ISO)
	sirolimus (ISO)
	sodium arsenite (EXP)
	sodium fluoride (EXP)
	Sporidesmin (ISO)
	streptozocin (EXP)
	zinc atom (ISO)
	zinc(0) (ISO)

Gene Ontology Annotations

Biological Process

	cell aging (IDA)
	cellular response to forskolin (IEP)
	cellular response to inorganic substance (IDA)
	long-term synaptic potentiation (IEP)

	regulation of dendrite development (IGI)
	regulation of neuron maturation (IGI)
	response to oxygen levels (IDA)

Cellular Component

postsynaptic density (IDA)

Molecular Pathway Annotations

	Huntington's disease pathway (IEP)
	Parkinson's disease pathway (ISO)

References - curated

1.	Feng Y, etal., J Neurol Sci. 2015 Feb 15;349(1-2):3-9. doi: 10.1016/j.jns.2014.12.017. Epub 2014 Dec 18.
2.	Lee ST, etal., Exp Neurol. 2011 Jan;227(1):172-9. doi: 10.1016/j.expneurol.2010.10.012. Epub 2010 Oct 28.
3.	RGD automated import pipeline
4.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

12007417 16369549 16381832 17369397 17604727 18452032 18723672 19559694 19843474 20010955 20159450 20215419 20307261 20413612 20668074 21037258 21057503 21059906 21118894 21124738 21206919 21267068 21372146 21611182 21718763 21892154 21892155 21945804 21993888 22144232 22246100 22315408 22328530 22659469 22693596 22706759 22874921 22897173 23011132 23184980 23264652 23520022 23658634 23780851 23818645 24381269 24431455 24657774 24877561 25635942 25751060 25813747 25858512 25862525 25885346 25945589 26084022 26107383 26121747 26319558 26362250 26371188 26773099 26921097 26947125 27165825 27422605 27484949 27539363 27579184 28065883 28244951 28314201 28381526 28423315 28429770 28448626 28534484 28592747 28615644 28670439 28807666 29017096 29661834 29678773 29846108 29982852 30342060 30679653 31004309

Genomics

Comparative Map Data

Mir132
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	11	75,173,682 - 75,173,747 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	11	74,987,184 - 74,987,249 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	11	82,680,626 - 82,680,691 (+)	NCBI		Celera
Cytogenetic Map	11	B5	NCBI

MIR132
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	2,049,908 - 2,050,008 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	17	1,953,202 - 1,953,302 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	1,899,951 - 1,900,051 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	17	1,969,847 - 1,969,947 (-)	NCBI
Cytogenetic Map	17	p13.3	NCBI
HuRef	17	1,849,221 - 1,849,321 (-)	NCBI		HuRef
CHM1_1	17	1,961,969 - 1,962,069 (-)	NCBI		CHM1_1

Mir132
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	10	62,014,995 - 62,015,095 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	62,014,995 - 62,015,095 (+)	Ensembl
Rnor_5.0	10	61,729,385 - 61,729,485 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	59,053,649 - 59,053,749 (+)	NCBI		Celera
Cytogenetic Map	10	q24	NCBI

MIR132
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	46,153,531 - 46,153,590 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	9		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
13208559	Wght10_m	weight 10 (mouse)					11	4000000	89000000	Mouse
13208558	Lgth12_m	body length 12 (mouse)					11	4000000	95000000	Mouse
1300905	Scc6_m	colon tumor susceptibility 6 (mouse)			Not determined		11	6930277	89128908	Mouse
1357859	Lvrq7_m	liver weight QTL 7 (mouse)			Not determined		11	12318637	118131898	Mouse
4141894	Nidd6k_m	Nidd6 on KK-A (mouse)			Not determined			19174204	97007000	Mouse
10412246	Dfs2_m	dental fluorosis suseptibility 2 (mouse)			Not determined		11	21857364	95990405	Mouse
13208569	Bmiq10_m	body mass index QTL 10 (mouse)					11	36000000	85000000	Mouse
1301328	Mol4_m	modifier of LPS-response 4 (mouse)			Not determined		11	36391750	83590530	Mouse
11532698	Sluc36a_m	susceptibility to lung cancer 36a (mouse)					11	42365791	76365904	Mouse
11532699	Sluc36b_m	susceptibility to lung cancer 36b (mouse)					11	42365791	76365904	Mouse
4142300	Ctrq3_m	C. trachomatis resistance QTL 3 (mouse)			Not determined		11	44739211	76963931	Mouse
4141367	Inf1_m	acute ozone induced inflammation (mouse)			Not determined			44739211	113167183	Mouse
4141000	Nidd3_m	non-insulin-dependent diabetes mellitus 3 (mouse)			Not determined			45151201	79151308	Mouse
1302021	Nidd1n_m	non-insulin-dependent diabetes mellitus 1 in NSY (mouse)			Not determined		11	45275046	80087498	Mouse
1357878	Mastr_m	modifier of astrocytoma (mouse)			Not determined		11	45817754	89927907	Mouse
1300765	Bbaa4_m	B.burgdorferi-associated arthritis 4 (mouse)			Not determined		11	46294341	80294436	Mouse
1301988	Bmd11_m	bone mineral density 11 (mouse)			Not determined		11	46428581	80428696	Mouse
1301830	Ssta4_m	susceptibility to Salmonella typhimurium antigens 4 (mouse)			Not determined		11	50187365	84187585	Mouse
13524840	Ppiq9a_m	prepulse inhibition QTL 9a (mouse)					11	52603559	86603559	Mouse
1300774	Pgia7_m	proteoglycan induced arthritis 7 (mouse)			Not determined		11	53499762	87499911	Mouse
4141830	Pregq1_m	pregnancy QTL 1 (mouse)			Not determined		11	54235926	83842826	Mouse
4142121	Tmc1m2_m	Tmc1 modifier 2 (mouse)			Not determined		11	56973201	114267131	Mouse
1300664	Etohcta9_m	ethanol conditioned taste aversion 9 (mouse)			Not determined		11	57863834	91863932	Mouse
1300924	Ity2_m	immunity to S. typhimurium 2 (mouse)			Not determined		1	58617204	87804412	Mouse
4141982	Skts-fp2_m	skin tumor susceptibility in FVB and PWK 2 (mouse)			Not determined			58828440	85175703	Mouse
1301987	Pid3_m	prior incubation determinant 3 (mouse)			Not determined		11	61795994	88808902	Mouse
1301319	Dautb4_m	dopamine uptake transporter binding 4 (mouse)			Not determined		11	62265179	96265327	Mouse
1301999	Lmr15_m	leishmaniasis resistance 15 (mouse)			Not determined		11	63428581	81939647	Mouse
10044004	Stzid3_m	streptozotocin induced diabetes susceptibility 3 (mouse)			Not determined		11	63428581	94173092	Mouse
11039501	Ltpr6a_m	Leishmania tropica response 6a (mouse)					11	64939510	98939647	Mouse
11039502	Ltpr6b_m	Leishmania tropica response 6b (mouse)					11	64939510	98939647	Mouse
11039515	Ltpr6_m	Leishmania tropica response 6 (mouse)					11	64939510	98939647	Mouse
1301546	Pcir2_m	periosteal circumference 2 (mouse)			Not determined		11	66842594	100842826	Mouse
1357766	Si5lq6_m	serum IGFBP-5 level QTL 6 (mouse)			Not determined		11	66842594	100842826	Mouse
4141012	Femwf6_m	femur work to failure 6 (mouse)			Not determined			66842594	100842826	Mouse
1301833	Tbbmd5_m	total body bone mineral density 5 (mouse)			Not determined		11	66842594	100842826	Mouse
1300784	Prdt3_m	prion disease incubation time 3 (mouse)			Not determined		11	66842594	100842826	Mouse
1300628	Lgth6_m	body length 6 (mouse)			Not determined		11	66842594	100842826	Mouse
4142316	Ity2b_m	immunity to S. typhimurium 2b (mouse)			Not determined		11	67187365	79923086	Mouse
1300651	Pcyts3_m	plasmacytoma susceptibility 3 (mouse)			Not determined		11	70800372	104800540	Mouse
1301681	Sle13_m	systematic lupus erythematosus susceptibility 13 (mouse)			Not determined		11	70800372	104800540	Mouse
1558812	Rafar_m	retinoic acid induced forelimb autopod reduction (mouse)			Not determined		11	70800372	104800540	Mouse
4141339	Nilac2_m	nicotine induced locomotor activity 2 (mouse)			Not determined		11	70800372	104800540	Mouse
1301404	Sbmd4_m	spinal bone mineral density 4 (mouse)			Not determined		11	72128823	106128908	Mouse
1301078	Alcp2_m	alcohol preference locus 2 (mouse)			Not determined		11	72318970	84840636	Mouse
1301310	Tmevd5_m	Theiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse)			Not determined		11	72835299	106835463	Mouse
4142348	Pstc2_m	periosteal circumference 2 (mouse)			Not determined		11	72927789	106927907	Mouse
10043866	Adip19_m	adiposity 19 (mouse)			Not determined		11	72927789	106927907	Mouse
12903994	Opfaq3_m	open field activity QTL 3 (mouse)					11	73846715	82178599	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Mecp2	mmu-miR-132-3p	Mirtarbase	external_info	Immunoblot//Immunohistochemistry//Immunoprecipitai	Functional MTI (Weak)	19843474
Mecp2	mmu-miR-132-3p	Mirtarbase	external_info	Immunoprecipitaion//Luciferase reporter assay//qRT	Functional MTI	21118894
Rfx4	mmu-miR-132-3p	Mirtarbase	external_info	Immunofluorescence//Immunohistochemistry//Microarr	Functional MTI (Weak)	17553428
Mmp9	mmu-miR-132-3p	Mirtarbase	external_info	Luciferase reporter assay//Reporter assay	Functional MTI	21057503
Nr4a2	mmu-miR-132-3p	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	22328530
Arhgap32	mmu-miR-132-3p	Mirtarbase	external_info	Luciferase reporter assay	Functional MTI	22246100
Tln2	mmu-miR-132-3p	OncomiRDB	external_info	NA	NA	22310291
Rb1	mmu-miR-132-3p	OncomiRDB	external_info	NA	NA	21329664
Ep300	mmu-miR-132-5p	Mirecords	external_info	NA	NA	21118894
Mmp9	mmu-miR-132-5p	Mirecords	external_info	NA	NA	21057503
Mmp9	mmu-miR-132-3p	Tarbase	external_info	Reporter Gene	POSITIVE

Predicted Targets

	Summary Value
Count of predictions:	12418
Count of gene targets:	6411
Count of transcripts:	10381
Interacting mature miRNAs:	mmu-miR-132-3p, mmu-miR-132-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029546	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AJ459743	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL603905	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608240	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029546

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	11	75,173,682 - 75,173,747 (+)	ENTREZGENE
MGSCv37	11	74,987,184 - 74,987,249 (+)	RGD
Celera	11	82,680,626 - 82,680,691 (+)	RGD
cM Map	11		ENTREZGENE

Sequence:

show sequence

GGGCAACCGTGGCTTTCGATTGTTACTGTGGGAACCGGAGGTAACAGTCTACAGCCATGGTCGC
CC

hide sequence

Promoters

RGD ID:

8675522

Promoter ID:

EPDNEW_M15792

Type:

multiple initiation site

Name:

Mir132_1

Description:

Mus musculus microRNA 132 , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	11	75,173,605 - 75,173,665	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676817	AgrOrtholog
Ensembl Genes	ENSMUSG00000065537	ENTREZGENE
Ensembl Transcript	ENSMUST00000083603	ENTREZGENE
MGD	MGI:2676817	ENTREZGENE
miRBase	MI0000158	ENTREZGENE
NCBI Gene	387150	ENTREZGENE
PhenoGen	Mir132	PhenoGen
RNAcentral	URS000032AEB0	RNACentral
	URS00006054DA	RNACentral
	URS000075ABE4	RNACentral

More on Mir132
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608339
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-29
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.