Mir182 (microRNA 182) - Rat Genome Database

Name: Mir182
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir182 (microRNA 182) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir182

Name:

microRNA 182

Description:

Involved in several processes, including cellular response to leukemia inhibitory factor; cellular response to lipopolysaccharide; and retinal cone cell development. Is expressed in several structures, including cranial ganglion; dorsal root ganglion; lung; neural tube; and sensory organ.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-182; Mirn182; mmu-mir-182

Orthologs:

Homo sapiens (human) : MIR182 (microRNA 182) HGNC

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR182 (microRNA 182)	HGNC	HGNC

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	6	30,165,918 - 30,165,992 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	6	30,115,918 - 30,115,992 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	30,172,634 - 30,172,708 (-)	NCBI		Celera
Cytogenetic Map	6	A3.3	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
pleomorphic xanthoastrocytoma		ISO	RGD:1346166	8554872	ClinVar Annotator: match by term: Pleomorphic xanthoastrocytoma	ClinVar	PMID:28299358

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Eye Injuries		ISO	RGD:1346166	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27208084
pancreatitis		ISO	RGD:1346166	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27840954
retinal disease		ISO	RGD:1346166	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27208084

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
1,3,5-trinitro-1,3,5-triazinane	decreases expression	EXP		6480464	cyclonite results in decreased expression of MIR182 mRNA	CTD	PMID:19270793
5-aza-2'-deoxycytidine	increases expression	ISO	RGD:1346166	6480464	Decitabine results in increased expression of MIR182 mRNA	CTD	PMID:17621267
5-aza-2'-deoxycytidine	multiple interactions	ISO	RGD:1346166	6480464	IL6 protein inhibits the reaction [Decitabine results in increased expression of MIR182 mRNA]	CTD	PMID:17621267
arsenous acid	multiple interactions	ISO	RGD:1346166	6480464	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in decreased expression of MIR182 mRNA], TGFB1 protein inhibits the reaction [Arsenic Trioxide results in decreased expression of MIR182 mRNA]	CTD	PMID:29662624
arsenous acid	decreases expression	ISO	RGD:1346166	6480464	Arsenic Trioxide results in decreased expression of MIR182 mRNA	CTD	PMID:29662624
diarsenic trioxide	multiple interactions	ISO	RGD:1346166	6480464	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in decreased expression of MIR182 mRNA], TGFB1 protein inhibits the reaction [Arsenic Trioxide results in decreased expression of MIR182 mRNA]	CTD	PMID:29662624
diarsenic trioxide	decreases expression	ISO	RGD:1346166	6480464	Arsenic Trioxide results in decreased expression of MIR182 mRNA	CTD	PMID:29662624
doxorubicin	increases expression	ISO	RGD:1346166	6480464	Doxorubicin results in increased expression of MIR182 mRNA	CTD	PMID:26842497
etoposide	increases expression	ISO	RGD:1346166	6480464	Etoposide results in increased expression of MIR182 mRNA	CTD	PMID:29397400
formaldehyde	decreases expression	ISO	RGD:1346166	6480464	Formaldehyde results in decreased expression of MIR182 mRNA	CTD	PMID:21147603
methimazole	multiple interactions	EXP		6480464	[Methimazole co-treated with Buthionine Sulfoximine] results in decreased expression of MIR182 mRNA	CTD	PMID:27421576
mibolerone	decreases expression	ISO	RGD:1346166	6480464	mibolerone results in decreased expression of MIR182 mRNA	CTD	PMID:25846647
N-acetyl-L-cysteine	multiple interactions	ISO	RGD:1346166	6480464	Acetylcysteine inhibits the reaction [Arsenic Trioxide results in decreased expression of MIR182 mRNA]	CTD	PMID:29662624
perfluorooctanoic acid	increases expression	EXP		6480464	perfluorooctanoic acid results in increased expression of MIR182 mRNA	CTD	PMID:25092180
S-butyl-DL-homocysteine (S,R)-sulfoximine	multiple interactions	EXP		6480464	[Methimazole co-treated with Buthionine Sulfoximine] results in decreased expression of MIR182 mRNA	CTD	PMID:27421576
sodium arsenite	multiple interactions	ISO	RGD:1346166	6480464	[MIR182 mRNA affects the susceptibility to sodium arsenite] which affects the expression of EPAS1 mRNA, [MIR182 mRNA affects the susceptibility to sodium arsenite] which affects the expression of EPAS1 protein	CTD	PMID:30334557
sodium arsenite	affects response to substance	ISO	RGD:1346166	6480464	MIR182 mRNA affects the susceptibility to sodium arsenite	CTD	PMID:30334557
sodium arsenite	decreases expression	ISO	RGD:1346166	6480464	sodium arsenite results in decreased expression of MIR182 mRNA	CTD	PMID:30334557
sodium arsenite	increases expression	EXP		6480464	sodium arsenite results in increased expression of MIR182 mRNA	CTD	PMID:24896083
sodium fluoride	increases expression	EXP		6480464	Sodium Fluoride results in increased expression of MIR182 mRNA	CTD	PMID:29127033
titanium dioxide	affects expression	EXP		6480464	titanium dioxide affects the expression of MIR182 mRNA	CTD	PMID:29247641
titanium dioxide	decreases expression	EXP		6480464	titanium dioxide results in decreased expression of MIR182 mRNA	CTD	PMID:29247641
zinc atom	multiple interactions	ISO	RGD:1346166	6480464	[MIR182 mRNA co-treated with MIR183 mRNA co-treated with MIR96 mRNA] results in decreased uptake of Zinc	CTD	PMID:22045813
zinc atom	decreases uptake	ISO	RGD:1346166	6480464	MIR182 mRNA results in decreased uptake of Zinc	CTD	PMID:22045813
zinc(0)	decreases uptake	ISO	RGD:1346166	6480464	MIR182 mRNA results in decreased uptake of Zinc	CTD	PMID:22045813
zinc(0)	multiple interactions	ISO	RGD:1346166	6480464	[MIR182 mRNA co-treated with MIR183 mRNA co-treated with MIR96 mRNA] results in decreased uptake of Zinc	CTD	PMID:22045813

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to leukemia inhibitory factor		IEP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
cellular response to lipopolysaccharide		IDA		2290270	(MGI:MGI:5050043, PMID:21247879)	MGI	MGI:MGI:5050043, PMID:21247879
female sex differentiation		IEP		2290270	(MGI:MGI:5528923, PMID:23946534)	MGI	MGI:MGI:5528923, PMID:23946534
gene expression		IGI		2290270	(MGI:MGI:6108693, PMID:28819115)	MGI	MGI:MGI:6108693, PMID:28819115
gene silencing by miRNA		IGI		2290270	(MGI:MGI:6108693, PMID:28819115)	MGI	MGI:MGI:6108693, PMID:28819115
regulation of gene expression		IGI	MGI:MGI:2676847, MGI:MGI:3619440	2290270	(MGI:MGI:5469752, PMID:23341629)	MGI	MGI:MGI:5469752, PMID:23341629
retina development in camera-type eye		IGI	MGI:MGI:2676847, MGI:MGI:3619440	2290270	(MGI:MGI:5469752, PMID:23341629)	MGI	MGI:MGI:5469752, PMID:23341629
retina development in camera-type eye		IGI		2290270	(MGI:MGI:6108693, PMID:28819115)	MGI	MGI:MGI:6108693, PMID:28819115
retinal cone cell development		IGI	MGI:MGI:2676847, MGI:MGI:3619440	2290270	(MGI:MGI:5469752, PMID:23341629)	MGI	MGI:MGI:5469752, PMID:23341629
sensory perception of sound		IEP		2290270	(MGI:MGI:5508842, PMID:23646144)	MGI	MGI:MGI:5508842, PMID:23646144
Wnt signaling pathway		IDA		2290270	(MGI:MGI:3639807, PMID:16682203)	MGI	MGI:MGI:3639807, PMID:16682203

Phenotype Annotations

Mammalian Phenotype

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
decreased metastatic potential		IAGP		5509061		MGI	PMID:25180607
no abnormal phenotype detected		IAGP		5509061		MGI	PMID:25180607

Disease Annotations

	Eye Injuries (ISO)
	pancreatitis (ISO)

	pleomorphic xanthoastrocytoma (ISO)
	retinal disease (ISO)

Gene-Chemical Interaction Annotations

	1,3,5-trinitro-1,3,5-triazinane (EXP)
	5-aza-2'-deoxycytidine (ISO)
	arsenous acid (ISO)
	diarsenic trioxide (ISO)
	doxorubicin (ISO)
	etoposide (ISO)

	formaldehyde (ISO)
	methimazole (EXP)
	mibolerone (ISO)
	N-acetyl-L-cysteine (ISO)
	perfluorooctanoic acid (EXP)
	S-butyl-DL-homocysteine (S,R)-sulfoximine (EXP)

	sodium arsenite (EXP,ISO)
	sodium fluoride (EXP)
	titanium dioxide (EXP)
	zinc atom (ISO)
	zinc(0) (ISO)

Gene Ontology Annotations

Biological Process

	cellular response to leukemia inhibitory factor (IEP)
	cellular response to lipopolysaccharide (IDA)
	female sex differentiation (IEP)
	gene expression (IGI)
	gene silencing by miRNA (IGI)
	regulation of gene expression (IGI)

	retina development in camera-type eye (IGI)
	retinal cone cell development (IGI)
	sensory perception of sound (IEP)
	Wnt signaling pathway (IDA)

Phenotype Annotations

Mammalian Phenotype

decreased metastatic potential (IAGP)

no abnormal phenotype detected (IAGP)

References - curated

1.	RGD automated import pipeline
2.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

12554859 15538371 16369549 16381832 16682203 17251443 17369397 17597072 17604727 18452032 19279690 19416898 19559694 19602392 19933188 20215419 20413612 20439489 20467336 20478254 20668074 21037258 21247879 21267068 21360794 21518438 21768104 21822254 22300508 22381690 22431396 22889583 23341629 23646144 23823476 23825948 23946534 24871856 24886554 25002228 25180607 25672759 25978641 26041499 26234681 26314219 26681446 26849109 26888314 27035623 27183593 27207535 27242323 27396327 27556515 27607577 27664932 27893611 27923913 28013219 28248712 28484004 28663557 28819115 28855441 28941704 29074972 29226948 29476110 30126905 30291236 30308195 30578296 30924851

Genomics

Comparative Map Data

Mir182
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	6	30,165,918 - 30,165,992 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	6	30,115,918 - 30,115,992 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	30,172,634 - 30,172,708 (-)	NCBI		Celera
Cytogenetic Map	6	A3.3	NCBI

MIR182
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	7	129,770,383 - 129,770,492 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	7	129,410,223 - 129,410,332 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	7	129,197,458 - 129,197,567 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	7	124,205,968 - 124,206,077 (-)	NCBI
Cytogenetic Map	7	q32.2	NCBI
HuRef	7	123,771,508 - 123,771,617 (-)	NCBI		HuRef
CHM1_1	7	129,343,614 - 129,343,723 (-)	NCBI		CHM1_1
CRA_TCAGchr7v2	7	128,794,499 - 128,794,608 (-)	NCBI

Position Markers

Mir182

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	6	30,165,773 - 30,166,779	UniSTS	GRCm38
MGSCv37	6	30,115,773 - 30,116,779	UniSTS	GRCm37
Celera	6	30,172,489 - 30,173,608	UniSTS
cM Map	6		UniSTS

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301131	Chol2_m	cholesterol 2 (mouse)			Not determined		6	1	32144496	Mouse
5491191	Mobq2_m	multigenic obesity QTL 2 (mouse)			Not determined		6	1	32144496	Mouse
1302024	Skull7_m	skull morphology 7 (mouse)			Not determined		6	1	32144496	Mouse
1300731	Smdq3_m	segregation of mitochondrial DNA QTL 3 (mouse)			Not determined		6	4249207	38249326	Mouse
1300556	Cia6_m	collagen induced arthritis QTL 6 (mouse)			Not determined		6	4464884	87426034	Mouse
11353840	Bmiq2_m	body mass index QTL 2 (mouse)					6	4503823	45314181	Mouse
1357481	Aaj2_m	anxiety in A/J 2 (mouse)			Not determined		6	4503823	48726677	Mouse
1357520	Axtq2_m	anxiety QTL 2 (mouse)			Not determined		6	4503823	48726677	Mouse
11353841	Bmiq3_m	body mass index QTL 3 (mouse)					6	4503823	48726677	Mouse
4142126	W3q3_m	weight 3 weeks QTL 3 (mouse)			Not determined			4503823	96656149	Mouse
4142361	W10q11_m	weight 10 weeks QTL 11 (mouse)			Not determined			4503823	96656149	Mouse
4142271	Egq8_m	early growth QTL 8 (mouse)			Not determined			4503823	96656149	Mouse
4142232	W6q4_m	weight 6 weeks QTL 4 (mouse)			Not determined			4503823	96656149	Mouse
1302051	Sluc7_m	susceptibility to lung cancer 7 (mouse)			Not determined		6	9297075	43297169	Mouse
10043869	Cia6a_m	collagen induced arthritis QTL 6a (mouse)			Not determined		6	12117972	46118070	Mouse
1301998	Bts2_m	bladder tumor susceptibility 2 (mouse)			Not determined		6	12751222	46751334	Mouse
4141749	Obrq2_m	obesity resistance QTL 2 (mouse)			Not determined			12751222	46751334	Mouse
1301724	Pcd4ts1_m	p-glycoprotein positive CD4 T cell subset 1 (mouse)			Not determined		6	17734663	51734784	Mouse
4140989	Spqq2_m	sperm quality QTL 2 (mouse)			Not determined			17734663	51734784	Mouse
1301850	Fglu_m	fasting glucose (mouse)			Not determined		6	17734663	51734784	Mouse
1357442	Dbts1_m	diabetes 1 (mouse)			Not determined		6	18234148	73387692	Mouse
12904940	Edlmmq5_m	extensor digitorum longus muscle mass QTL 5 (mouse)					6	19639411	53639411	Mouse
12904943	Tammq4_m	tibialis anterior muscle mass QTL 4 (mouse)					6	19639411	53639411	Mouse
12904952	Gmmq4_m	gastrocnemius muscle mass QTL 4 (mouse)					6	19639411	53639411	Mouse
10412213	Sxbq2_m	SGC/Knj cross B6 QTL 2 (mouse)			Not determined		6	19912686	71322775	Mouse
10412107	Desp4_m	despair 4 (mouse)			Not determined		6	20072895	54072895	Mouse
14700690	Ccs6_m	colon cancer susceptibility 6 (mouse)					6	23800000	57800000	Mouse
13208564	Bmiq7_m	body mass index QTL 7 (mouse)					6	25000000	80000000	Mouse
4141988	Obrq3_m	obesity resistance QTL 3 (mouse)			Not determined			28314059	62314181	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Tbx1	mmu-miR-182-5p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR	Functional MTI	22381690
Pfn1	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23430586
Foxf2	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23383207
Snai2	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23354685
Gna13	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23329838
Pdcd4	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23296900
Foxo3	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23262295
Cyld	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	23006329
Mtss1	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	22681717
Creb1	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	22325466
Brca1	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	21195000
Rgs17	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	20420807
Foxo1	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	19574223
Foxo3	mmu-miR-182-5p	OncomiRDB	external_info	NA	NA	19188590

Predicted Targets

	Summary Value
Count of predictions:	22375
Count of gene targets:	8854
Count of transcripts:	14815
Interacting mature miRNAs:	mmu-miR-182-3p, mmu-miR-182-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029569	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC153632	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ560724	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608304	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029569

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	6	30,165,918 - 30,165,992 (-)	ENTREZGENE
MGSCv37	6	30,115,918 - 30,115,992 (-)	RGD
Celera	6	30,172,634 - 30,172,708 (-)	RGD
cM Map	6		ENTREZGENE

Sequence:

show sequence

ACCATTTTTGGCAATGGTAGAACTCACACCGGTAAGGTAATGGGACCCGGTGGTTCTAGACTTG
CCAACTATGGT

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000076361	ENTREZGENE
Ensembl Transcript	ENSMUST00000102406	ENTREZGENE
MGD	MGI:2676846	ENTREZGENE
miRBase	MI0000224	ENTREZGENE
NCBI Gene	387177	ENTREZGENE
PhenoGen	Mir182	PhenoGen
RNAcentral	URS00003D5044	RNACentral
	URS000059D941	RNACentral
	URS000075DA6B	RNACentral

More on Mir182
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608314
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-29
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.