Mir188 (microRNA 188) - Rat Genome Database

Name: Mir188
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir188 (microRNA 188) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir188

Name:

microRNA 188

Description:

Involved in several processes, including bone marrow development; regulation of fat cell differentiation; and regulation of osteoblast differentiation. Is expressed in cranial ganglion; dorsal root ganglion; and neural retina.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-188; Mirn188; mmu-mir-188

Orthologs:

Homo sapiens (human) : MIR188 (microRNA 188) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir188 (microRNA 188) Alliance
Canis lupus familiaris (dog) : MIR188 (microRNA mir-188)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR188 (microRNA 188)	HGNC	Ensembl
Rattus norvegicus (Norway rat):	Mir188 (microRNA 188)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR188 (microRNA mir-188)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	X	7,247,989 - 7,248,056 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	X	6,825,115 - 6,825,182 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	4,223,780 - 4,223,847 (+)	NCBI		Celera
Cytogenetic Map	X	A1.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
autistic disorder		ISO	RGD:1352314	8554872	ClinVar Annotator: match by term: Autistic disorder of childhood onset	ClinVar	PMID:21681106, PMID:30208311
Dent Disease 1		ISO	RGD:1352314	8554872	ClinVar Annotator: match by term: Dent disease 1	ClinVar	PMID:15052463
Dent Disease 1		ISO	RGD:1352314	8554872	ClinVar Annotator: match by term: Dent disease 1	ClinVar	PMID:7874126
Dent Disease 1		ISO	RGD:1352314	8554872	ClinVar Annotator: match by term: Dent disease 1	ClinVar	PMID:9328929

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Chemical and Drug Induced Liver Injury		ISO	RGD:1352314	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106
Myocardial Reperfusion Injury		ISO	RGD:1352314	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22050707

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	RGD:1352314	6480464	Tetrachlorodibenzodioxin results in increased expression of MIR188 mRNA	CTD	PMID:30096437
2-methoxyethanol	increases expression	ISO	RGD:2325505	6480464	methyl cellosolve results in increased expression of MIR188 mRNA	CTD	PMID:22008535
acrolein	decreases expression	ISO	RGD:1352314	6480464	Acrolein results in decreased expression of MIR188	CTD	PMID:24812010
arsane	multiple interactions	EXP		6480464	[APOE protein affects the susceptibility to Arsenic] which results in decreased expression of MIR188 mRNA	CTD	PMID:22719926
arsenic atom	multiple interactions	EXP		6480464	[APOE protein affects the susceptibility to Arsenic] which results in decreased expression of MIR188 mRNA	CTD	PMID:22719926
bisphenol A	increases methylation	ISO	RGD:2325505	6480464	bisphenol A results in increased methylation of MIR188 gene	CTD	PMID:28505145
bleomycin A2	affects expression	ISO	RGD:2325505	6480464	Bleomycin affects the expression of MIR188 mRNA	CTD	PMID:25933445
cisplatin	increases expression	ISO	RGD:2325505	6480464	Cisplatin results in increased expression of MIR188 mRNA	CTD	PMID:24880025
decabromodiphenyl ether	increases expression	ISO	RGD:1352314	6480464	decabromobiphenyl ether results in increased expression of MIR188 mRNA	CTD	PMID:26252056
hexanal	decreases expression	ISO	RGD:2325505	6480464	n-hexanal results in decreased expression of MIR188 mRNA	CTD	PMID:26403475
hydrogen peroxide	increases expression	ISO	RGD:1352314	6480464	Hydrogen Peroxide results in increased expression of MIR188 mRNA	CTD	PMID:26339600
methimazole	multiple interactions	EXP		6480464	[Methimazole co-treated with Buthionine Sulfoximine] results in increased expression of MIR188 mRNA	CTD	PMID:27421576
paracetamol	increases expression	ISO	RGD:1352314	6480464	Acetaminophen results in increased expression of MIR188 mRNA	CTD	PMID:28545106
paraquat	increases expression	ISO	RGD:1352314	6480464	Paraquat results in increased expression of MIR188 mRNA	CTD	PMID:28619522
perfluorooctane-1-sulfonic acid	increases expression	ISO	RGD:2325505	6480464	perfluorooctane sulfonic acid results in increased expression of MIR188 mRNA	CTD	PMID:24420840
S-butyl-DL-homocysteine (S,R)-sulfoximine	multiple interactions	EXP		6480464	[Methimazole co-treated with Buthionine Sulfoximine] results in increased expression of MIR188 mRNA	CTD	PMID:27421576
streptozocin	increases expression	EXP		6480464	Streptozocin results in increased expression of MIR188 mRNA	CTD	PMID:27629361
titanium dioxide	increases expression	EXP		6480464	titanium dioxide results in increased expression of MIR188 mRNA	CTD	PMID:29247641

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
bone marrow development		IMP		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
bone marrow development		IDA		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
cell aging		IDA		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
regulation of fat cell differentiation		IMP		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
regulation of fat cell differentiation		IDA		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
regulation of gene expression		IMP		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
regulation of osteoblast differentiation		IMP		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
regulation of osteoblast differentiation		IDA		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060

Phenotype Annotations

Mammalian Phenotype

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
abnormal fat cell differentiation		IAGP		5509061		MGI	PMID:25751060
abnormal fat cell morphology		IAGP		5509061		MGI	PMID:25751060
abnormal skeleton development		IAGP		5509061		MGI	PMID:25751060
decreased bone trabecular spacing		IAGP		5509061		MGI	PMID:25751060
decreased internal diameter of femur		IAGP		5509061		MGI	PMID:25751060
increased bone ossification		IAGP		5509061		MGI	PMID:25751060
increased bone stiffness		IAGP		5509061		MGI	PMID:25751060
increased bone strength		IAGP		5509061		MGI	PMID:25751060
increased bone trabecula number		IAGP		5509061		MGI	PMID:25751060
increased bone volume		IAGP		5509061		MGI	PMID:25751060
increased femur compact bone thickness		IAGP		5509061		MGI	PMID:25751060
increased osteoblast cell number		IAGP		5509061		MGI	PMID:25751060
increased trabecular bone volume		IAGP		5509061		MGI	PMID:25751060

Disease Annotations

	autistic disorder (ISO)
	Chemical and Drug Induced Liver Injury (ISO)

	Dent Disease 1 (ISO)
	Myocardial Reperfusion Injury (ISO)

Gene-Chemical Interaction Annotations

	2,3,7,8-tetrachlorodibenzodioxine (ISO)
	2-methoxyethanol (ISO)
	acrolein (ISO)
	arsane (EXP)
	arsenic atom (EXP)
	bisphenol A (ISO)
	bleomycin A2 (ISO)

	cisplatin (ISO)
	decabromodiphenyl ether (ISO)
	hexanal (ISO)
	hydrogen peroxide (ISO)
	methimazole (EXP)
	paracetamol (ISO)
	paraquat (ISO)

	perfluorooctane-1-sulfonic acid (ISO)
	S-butyl-DL-homocysteine (S,R)-sulfoximine (EXP)
	streptozocin (EXP)
	titanium dioxide (EXP)

Gene Ontology Annotations

Biological Process

	bone marrow development (IDA,IMP)
	cell aging (IDA)
	regulation of fat cell differentiation (IDA,IMP)

	regulation of gene expression (IMP)
	regulation of osteoblast differentiation (IDA,IMP)

Phenotype Annotations

Mammalian Phenotype

	abnormal fat cell differentiation (IAGP)
	abnormal fat cell morphology (IAGP)
	abnormal skeleton development (IAGP)
	decreased bone trabecular spacing (IAGP)
	decreased internal diameter of femur (IAGP)

	increased bone ossification (IAGP)
	increased bone stiffness (IAGP)
	increased bone strength (IAGP)
	increased bone trabecula number (IAGP)
	increased bone volume (IAGP)

	increased femur compact bone thickness (IAGP)
	increased osteoblast cell number (IAGP)
	increased trabecular bone volume (IAGP)

References - curated

1.	RGD automated import pipeline
2.	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
3.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

12554859 15538371 16381832 17369397 17604727 20215419 20413612 21037258 21267068 22570807 25378159 25751060 25858075 27708404 28640956 29663375 29908885 30253270

Genomics

Comparative Map Data

Mir188
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	X	7,247,989 - 7,248,056 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	X	6,825,115 - 6,825,182 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	4,223,780 - 4,223,847 (+)	NCBI		Celera
Cytogenetic Map	X	A1.1	NCBI

MIR188
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	X	50,003,503 - 50,003,588 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	X	49,768,109 - 49,768,194 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	X	49,654,848 - 49,654,933 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	X	53,837,336 - 53,837,421 (+)	NCBI
Cytogenetic Map	X	p11.23	NCBI
HuRef	X	47,238,055 - 47,238,140 (+)	NCBI		HuRef
CHM1_1	X	49,847,897 - 49,847,982 (+)	NCBI		CHM1_1

Mir188
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	X	16,110,270 - 16,110,349 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	16,110,270 - 16,110,349 (+)	Ensembl
Rnor_5.0	X	16,895,394 - 16,895,473 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	X	15,327,046 - 15,327,125 (+)	NCBI		Celera
Cytogenetic Map	X	q12	NCBI

MIR188
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	X	42,775,058 - 42,775,143 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	X		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1302195	Pbwg10_m	postnatal body weight growth 10 (mouse)			Not determined		X	1	26335934	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	20306
Count of gene targets:	9232
Count of transcripts:	15904
Interacting mature miRNAs:	mmu-miR-188-3p, mmu-miR-188-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029574	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AJ560730	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL663104	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608310	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029574

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	X	7,247,989 - 7,248,056 (-)	ENTREZGENE
MGSCv37	X	6,825,115 - 6,825,182 (-)	RGD
Celera	X	4,223,780 - 4,223,847 (+)	RGD
cM Map	X		ENTREZGENE

Sequence:

show sequence

TCTCACATCCCTTGCATGGTGGAGGGTGAGCTCTCTGAAAACCCCTCCCACATGCAGGGTTTGC
AGGA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065398	ENTREZGENE
Ensembl Transcript	ENSMUST00000083464	ENTREZGENE
MGD	MGI:2676852	ENTREZGENE
miRBase	MI0000230	ENTREZGENE
NCBI Gene	387183	ENTREZGENE
PhenoGen	Mir188	PhenoGen
RNAcentral	URS0000083D87	RNACentral
	URS000061AB33	RNACentral
	URS000075AB10	RNACentral

More on Mir188
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608308
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-16
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.