Mir201 (microRNA 201) - Rat Genome Database

Name: Mir201
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir201 (microRNA 201) Mus musculus

Analyze

Symbol:

Mir201

Name:

microRNA 201

RGD ID:

1608294

MGI Page

MGI

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-201; Mirn; Mirn201; mmu-mir-2; mmu-mir-201

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	67,031,702 - 67,031,767 (-)	NCBI	GRCm39		mm39
GRCm38	X	67,988,096 - 67,988,161 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	67,988,096 - 67,988,161 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	65,241,271 - 65,241,336 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	53,822,930 - 53,822,995 (+)	NCBI		Celera
Cytogenetic Map	X	A7.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Myocardial Reperfusion Injury (EXP)

References

Additional References at PubMed

PMID:12554859	PMID:12554860	PMID:16381832	PMID:17369397	PMID:17604727	PMID:20215419	PMID:20413612	PMID:21037258	PMID:21267068	PMID:22144232

Genomics

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357433	Dbts2_m	diabetes 2 (mouse)			Not determined		X	7360056	151324042	Mouse
13208567	Bmiq12_m	body mass index QTL 12 (mouse)					X	36000000	78000000	Mouse
4141565	Pbwg21_m	postnatal body weight growth 21 (mouse)			Not determined		X	40068354	74068454	Mouse
1301009	Pbwg7_m	postnatal body weight growth 7 (mouse)			Not determined		X	40068354	74068454	Mouse
1300794	Spha2_m	sperm head anomaly 2 (mouse)			Not determined		X	40832621	87216531	Mouse
4142200	Rtwq1_m	reduced testis weight QTL 1 (mouse)			Not determined			42431700	76431843	Mouse
1301278	Bdln1_m	body length 1 (mouse)			Not determined		X	42656746	76656858	Mouse
1300702	Fcsa4_m	femoral cross-sectional area 4 (mouse)			Not determined		X	46983838	80983961	Mouse
4141630	Gct6_m	granulosa cell tumorigenesis 6 (mouse)			Not determined			48090244	130864007	Mouse
1301351	Obq6_m	obesity QTL 6 (mouse)			Not determined		X	51683498	71391145	Mouse
25314311	Syncl3_m	synaptonemal complex length 3 (mouse)					X	52900000	90700000	Mouse
13824980	Ferq1_m	genetic fertility QTL 1 (mouse)					X	55000000	150000000	Mouse
10412108	Desp5_m	despair 5 (mouse)			Not determined		X	55678745	89678745	Mouse
13464140	Hdlq108_m	HDL QTL 108 (mouse)					X	58728354	92728354	Mouse
25314316	Mlh1fc3_m	MLH1 foci count 3 (mouse)					X	62300000	90800000	Mouse
12050071	Hstx2_m	hybrid sterility, X chromosome 2 (mouse)					X	64880641	69581094	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	18896
Count of gene targets:	8247
Count of transcripts:	13306
Interacting mature miRNAs:	mmu-miR-201-3p, mmu-miR-201-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029588	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AJ560742	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL671976	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AY194862	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608323	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083470

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	X	67,988,096 - 67,988,161 (-)	Ensembl

RefSeq Acc Id:

NR_029588

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	X	67,031,702 - 67,031,767 (-)	NCBI
GRCm38	X	67,988,096 - 67,988,161 (-)	ENTREZGENE
MGSCv37	X	65,241,271 - 65,241,336 (-)	RGD
Celera	X	53,822,930 - 53,822,995 (+)	RGD
cM Map	X		ENTREZGENE

Sequence:

show sequence

TACCTTACTCAGTAAGGCATTGTTCTTCTATATTAATAAATGAACAGTGCCTTTCTGTGTAGGG
TA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065404	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083470	ENTREZGENE
MGD	MGI:2676876	ENTREZGENE
miRBase	MI0000244	ENTREZGENE
NCBI Gene	387197	ENTREZGENE
PhenoGen	Mir201	PhenoGen
RNAcentral	URS000010FA41	RNACentral
	URS00001E8140	RNACentral
	URS000075A62C	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD