Mir30e (microRNA 30e) - Rat Genome Database

Name: Mir30e
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir30e (microRNA 30e) Mus musculus

Analyze

Symbol:

Mir30e

Name:

microRNA 30e

RGD ID:

1608216

MGI Page

MGI

Description:

Is expressed in liver. Orthologous to human MIR30E (microRNA 30e).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-30e; Mirn; Mirn30e; mmu-mir-3; mmu-mir-30e

RGD Orthologs

Human

Rat

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	4	120,629,803 - 120,629,894 (-)	NCBI	GRCm39		mm39
GRCm39 Ensembl	4	120,629,803 - 120,629,894 (-)	Ensembl
GRCm38	4	120,772,606 - 120,772,697 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	4	120,772,606 - 120,772,697 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	4	120,445,211 - 120,445,302 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	4	119,490,804 - 119,490,895 (-)	NCBI		Celera
Cytogenetic Map	4	D2.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Contrast-Induced Nephropathy (ISO)

Experimental Liver Neoplasms (ISO)

Fibrosis (ISO)

Hearing Loss, Noise-Induced (ISO)

kidney disease (ISO)

Neoplasm Metastasis (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(+)-schisandrin B (ISO)

1,3,5-trinitro-1,3,5-triazinane (EXP)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2-hydroxypropanoic acid (ISO)

aflatoxin B1 (ISO)

all-trans-retinoic acid (ISO)

bis(2-chloroethyl) sulfide (EXP)

bis(2-ethylhexyl) phthalate (ISO)

bisphenol A (ISO)

bleomycin A2 (ISO)

cadmium dichloride (ISO)

choline (EXP)

cisplatin (ISO)

cyclosporin A (ISO)

dibutyl phthalate (ISO)

ethanol (EXP)

folic acid (EXP)

hydrogen peroxide (ISO)

icariin (EXP)

isoprene (ISO)

L-methionine (EXP)

methapyrilene (ISO)

nitrogen dioxide (EXP)

paracetamol (EXP,ISO)

progesterone (ISO)

quartz (ISO)

rac-lactic acid (ISO)

resveratrol (EXP,ISO)

sodium arsenite (ISO)

sodium fluoride (EXP)

sulfur dioxide (EXP)

tetrachloromethane (EXP)

thalidomide (EXP)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (IDA)

cellular response to ethanol (IEP)

cellular response to forskolin (IEP)

cellular response to inorganic substance (IDA)

long-term synaptic potentiation (IEP)

response to bacterium (IEP)

response to oxygen levels (IDA)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions
2.	Sun SQ, etal., J Am Heart Assoc. 2016 Aug 15;5(8). pii: JAHA.116.004138. doi: 10.1161/JAHA.116.004138.

Additional References at PubMed

PMID:12007417	PMID:12919684	PMID:15538371	PMID:16381832	PMID:16766679	PMID:17369397	PMID:17604727	PMID:18452032	PMID:19091803	PMID:19185580	PMID:19188439	PMID:19229884
PMID:20215419	PMID:20413612	PMID:20548288	PMID:21037258	PMID:21267068	PMID:21822254	PMID:21993888	PMID:22144232	PMID:22512273	PMID:22570807	PMID:22854828	PMID:23515048
PMID:24113179	PMID:24205035	PMID:25678587	PMID:25858512	PMID:26786283	PMID:27974319	PMID:28338991	PMID:28733476	PMID:29274035	PMID:30816428	PMID:32535037

Genomics

Comparative Map Data

Mir30e
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	4	120,629,803 - 120,629,894 (-)	NCBI	GRCm39		mm39
GRCm39 Ensembl	4	120,629,803 - 120,629,894 (-)	Ensembl
GRCm38	4	120,772,606 - 120,772,697 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	4	120,772,606 - 120,772,697 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	4	120,445,211 - 120,445,302 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	4	119,490,804 - 119,490,895 (-)	NCBI		Celera
Cytogenetic Map	4	D2.1	NCBI

MIR30E
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	1	40,754,355 - 40,754,446 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	1	40,754,355 - 40,754,446 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	1	41,220,027 - 41,220,118 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	1	40,992,613 - 40,992,704 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	1	39,502,227 - 39,502,318 (+)	NCBI
Cytogenetic Map	1	p34.2	NCBI
HuRef	1	39,338,148 - 39,338,239 (+)	NCBI		HuRef
CHM1_1	1	41,335,858 - 41,335,949 (+)	NCBI		CHM1_1

Mir30e
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	5	134,352,232 - 134,352,323 (-)	NCBI
Rnor_6.0 Ensembl	5	139,702,872 - 139,702,963 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	5	139,702,872 - 139,702,963 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	5	143,497,752 - 143,497,843 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	5	132,906,563 - 132,906,654 (-)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

MIR30E
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	15	2,283,306 - 2,283,369 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	15	2,283,306 - 2,283,369 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

MIR30E
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	6	170,429,841 - 170,429,920 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	6	170,429,841 - 170,429,920 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	6	157,476,655 - 157,476,734 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
11567249	Elorr3_m	ethanol induced loss of righting response 3 (mouse)					4	3722677	156183778	Mouse
26884449	Sklq2_m	skull length QTL 2, 5 week (mouse)					4	36700000	129100000	Mouse
1357895	Ctrcts_m	cataract severity (mouse)			Not determined		4	45709925	138615442	Mouse
11532714	Sluc43_m	susceptibility to lung cancer 43 (mouse)					4	46642108	123233418	Mouse
4141900	Skts-fp1_m	skin tumor susceptibility in FVB and PWK 1 (mouse)			Not determined		4	53550839	124161387	Mouse
27095905	Scvln3_m	sacral vertebrae length 2, 5 week (mouse)					4	55600000	129100000	Mouse
26884437	Sklq13_m	skull length QTL 13, 16 week (mouse)					4	57700000	155600000	Mouse
25314312	Syncl2_m	synaptonemal complex length 2 (mouse)					4	65800000	146500000	Mouse
27095917	Scvln14_m	sacral vertebrae length 2, 16 week (mouse)					4	68100000	130500000	Mouse
26884445	Sklq7_m	skull length QTL 7, 10 week (mouse)					4	68100000	150800000	Mouse
27095924	Pglq2_m	pelvic girdle length QTL 2, 5 week (mouse)					4	69200000	131000000	Mouse
1301597	Anxty_m	anxiety (mouse)			Not determined		4	74219337	128115487	Mouse
4141549	W10q10_m	weight 10 weeks QTL 10 (mouse)			Not determined			89063832	140740892	Mouse
4141093	W3q17_m	weight 3 weeks QTL 17 (mouse)			Not determined			89063832	140740892	Mouse
4141623	W6q13_m	weight 6 weeks QTL 13 (mouse)			Not determined			89063832	140740892	Mouse
1357529	Lvrq8_m	liver weight QTL 8 (mouse)			Not determined		4	89063832	140740892	Mouse
39128212	Lwq21_m	liver weight QTL 21 (mouse)					4	89063832	140740892	Mouse
1301823	Bmd7_m	bone mineral density 7 (mouse)			Not determined		4	89063832	151570093	Mouse
1300918	Stheal4_m	soft tissue heal 4 (mouse)			Not determined		4	90112430	124112550	Mouse
11553870	Cmmm_m	carcinoma modifier of MSM (mouse)					4	90733471	124733584	Mouse
13208562	Wght7_m	weight 7 (mouse)					4	91000000	148000000	Mouse
15039368	Nmrs19_m	NAFLD-associated magnetic resonance shift 19 (mouse)					4	91025583	125025583	Mouse
12904002	Opfaq9_m	open field activity QTL 9 (mouse)					4	93118593	127118593	Mouse
1301731	Cafq2_m	caffeine metabolism QTL 2 (mouse)			Not determined		4	94875058	128875257	Mouse
1301233	Sbw2_m	splenomegaly-NZB x NZW 2 (mouse)			Not determined		4	95069342	128115487	Mouse
1301815	Sles2_m	systemic lupus erythmatosus suppressor 2 (mouse)			Not determined		4	95069342	150592401	Mouse
1300580	Lbw2_m	lupus NZB x NZW 2 (mouse)			Not determined		4	98657302	128115487	Mouse
1301106	Skts7_m	skin tumor susceptibility 7 (mouse)			Not determined		4	100214774	134215009	Mouse
1301847	Fecq2_m	fecundity QTL 2 (mouse)			Not determined		4	100214774	134215009	Mouse
14696689	Gdq2_m	grooming duration QTL 2, females (mouse)					4	101000000	125000000	Mouse
12880433	Fgf23lq1_m	FGF23 serum level QTL 1 (mouse)					4	101300000	135300000	Mouse
1300689	Dob1_m	Dietary obesity 1 (mouse)			Body weight		4	101717404	123233418	Mouse
15039377	Bw45_m	body weight QTL 45 (mouse)					4	105812001	139812001	Mouse
15039378	Adip30_m	adiposity 30 (mouse)					4	105812001	139812001	Mouse
15039382	Ltgq7_m	liver triglyceride QTL 7 (mouse)					4	105812001	139812001	Mouse
12910794	Pwbwq8_m	post-weaning body weight QTL 8 (mouse)					4	105978113	141706527	Mouse
12910797	Pwgrq4_m	pre-weaning growth rate QTL 4 (mouse)					4	105978113	141706527	Mouse
12910808	Pwbwq9_m	post-weaning body weight QTL 9 (mouse)					4	105978113	141706527	Mouse
12910813	Pwbwq4_m	pre-weaning body weight QTL 4 (mouse)					4	105978113	141706527	Mouse
1357800	Tgq3_m	triglyceride QTL 3 (mouse)			Not determined		4	107161300	141161387	Mouse
1300663	Start2_m	startle response 2 (mouse)			Not determined		4	107371164	141371360	Mouse
1300809	Ccrs2_m	corpus callosum hemisphere surface size 2 (mouse)			Not determined		4	107371164	141371360	Mouse
1300781	Lith8_m	lithogenic gene 8 (mouse)			Not determined		4	107371164	141371360	Mouse
1301382	Arvm2_m	autoimmune renal vasculitis 2 (mouse)			Not determined		4	107897771	141897963	Mouse
10755520	Rbc1_m	red blood cell count 1 (mouse)					4	108583899	142583899	Mouse
10755522	Hgb1_m	hemoglobin 1 (mouse)					4	108583899	142583899	Mouse
10755521	Hct1_m	hematocrit 1 (mouse)					4	108583899	142583899	Mouse
10412072	Ssen1_m	suseptibility to Sendai virus 1 (mouse)			Not determined		4	109800935	133427471	Mouse
13208565	Bmiq6_m	body mass index QTL 6 (mouse)					4	111000000	126000000	Mouse
1300839	Dyscalc2_m	dystrophic cardiac calcinosis 2 (mouse)			Not determined		4	111115258	145115487	Mouse
1300743	Skull6_m	skull morphology 6 (mouse)			Not determined		4	111115258	145115487	Mouse
15039385	Mvlq3_m	macrovesicular liver lesion QTL 3 (mouse)					4	112288593	146288593	Mouse
4141001	Tgq17_m	triglyceride QTL 17 (mouse)			Not determined			112629696	146629696	Mouse
10047132	Albq19_m	albuminuria QTL 19 (mouse)			Not determined		4	112930596	146930596	Mouse
1300655	Nidds_m	non-insulin-dependent diabetes mellitus in SJL (mouse)			Not determined		4	115173580	129572122	Mouse
1301996	Mmtg2_m	modifier of mammary tumor growth 2 (mouse)			Not determined		4	116413782	124161387	Mouse
4142493	Femwf13_m	femur work to failure 13 (mouse)			Not determined			116427367	150427471	Mouse
4141330	Iva1_m	isovaleric acid smelling 1 (mouse)			Not determined			117214774	120866006	Mouse
1302078	Sluc21_m	susceptibility to lung cancer 21 (mouse)			Not determined		4	117673830	151673964	Mouse
14746982	Manh56_m	mandible shape 56 (mouse)					4	118088606	152088606	Mouse
12903992	Opfaq6_m	open field activity QTL 6 (mouse)					4	119207798	121509300	Mouse
1301964	Bw8q2_m	body weight at 8 weeks QTL 2 (mouse)			Not determined		4	120137122	154137225	Mouse
1302102	Bis1_m	beta-carboline-induced seizures 1 (mouse)			Not determined		4	120137122	154137225	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Nfkbia	mmu-miR-30e-3p	OncomiRDB	external_info	NA	NA	22156201
Helz	mmu-miR-30e-3p	OncomiRDB	external_info	NA	NA	21963845
Ucp2	mmu-miR-30e-5p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot	Functional MTI	23515048
Slc35e1	mmu-miR-30e-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Sfmbt1	mmu-miR-30e-5p	Tarbase	external_info	Sequencing	POSITIVE
Myb	mmu-miR-30e-5p	OncomiRDB	external_info	NA	NA	21187425
Ube2i	mmu-miR-30e-5p	OncomiRDB	external_info	NA	NA	20498642
Ube2i	mmu-miR-30e-5p	OncomiRDB	external_info	NA	NA	19223510

Predicted Targets

	Summary Value
Count of predictions:	23909
Count of gene targets:	9113
Count of transcripts:	15052
Interacting mature miRNAs:	mmu-miR-30e-3p, mmu-miR-30e-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029602	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL606904	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608335	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083475

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	4	120,772,606 - 120,772,697 (-)	Ensembl

RefSeq Acc Id:

NR_029602

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	4	120,629,803 - 120,629,894 (-)	NCBI
GRCm38	4	120,772,606 - 120,772,697 (-)	ENTREZGENE
MGSCv37	4	120,445,211 - 120,445,302 (-)	RGD
Celera	4	119,490,804 - 119,490,895 (-)	RGD
cM Map	4		ENTREZGENE

Sequence:

show sequence

GGGCAGTCTTTGCTACTGTAAACATCCTTGACTGGAAGCTGTAAGGTGTTGAGAGGAGCTTTCA
GTCGGATGTTTACAGCGGCAGGCTGCCA

hide sequence

Promoters

RGD ID:

6884494

Promoter ID:

EPDNEW_M5698

Type:

single initiation site

Name:

Mir30e_1

Description:

Mus musculus microRNA 30e , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	4	120,772,616 - 120,772,676	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619329	AgrOrtholog
Ensembl Genes	ENSMUSG00000065409	Ensembl
	ENSMUSG00000119752	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083475	ENTREZGENE
MGD	MGI:3619329	ENTREZGENE
miRBase	MI0000259	ENTREZGENE
NCBI Gene	723836	ENTREZGENE
PhenoGen	Mir30e	PhenoGen
RNAcentral	URS00001DE669	RNACentral
	URS00004DC6A5	RNACentral
	URS0000759D99	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD