Mir30e (microRNA 30e) - Rat Genome Database

Name: Mir30e
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir30e (microRNA 30e) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir30e

Name:

microRNA 30e

Description:

Involved in several processes, including cellular response to alcohol; cellular response to amino acid stimulus; and long-term synaptic potentiation.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-30e; Mirn30e; mmu-mir-30e

Orthologs:

Homo sapiens (human) : MIR30E (microRNA 30e) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir30e (microRNA 30e) Alliance
Canis lupus familiaris (dog) : MIR30E (microRNA mir-30e)
Sus scrofa (pig) : MIR30E (microRNA mir-30e)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR30E (microRNA 30e)	HGNC	Ensembl
Rattus norvegicus (Norway rat):	Mir30e (microRNA 30e)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR30E (microRNA mir-30e)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MIR30E (microRNA mir-30e)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	4	120,772,606 - 120,772,697 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	4	120,445,211 - 120,445,302 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	4	119,490,804 - 119,490,895 (-)	NCBI		Celera
Cytogenetic Map	4	D2.2	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Experimental Liver Neoplasms		ISO	RGD:1354313	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:21035526
Hearing Loss, Noise-Induced		ISO	RGD:1354313	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23472202
Neoplasm Metastasis		ISO	RGD:1354313	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:19487542

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
1,3,5-trinitro-1,3,5-triazinane	increases expression	EXP		6480464	cyclonite results in increased expression of MIR30E mRNA, cyclonite results in increased expression of MIR30E mRNA modified form	CTD	PMID:19270793
2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	RGD:1354313	6480464	Tetrachlorodibenzodioxin results in increased expression of MIR30E mRNA	CTD	PMID:30096437
2-(2,6-dioxopiperidin-3-yl)-1H-isoindole-1,3(2H)-dione	decreases expression	EXP		6480464	Thalidomide results in decreased expression of MIR30E mRNA	CTD	PMID:26217789
2-hydroxypropanoic acid	increases expression	ISO	RGD:1354313	6480464	Lactic Acid results in increased expression of MIR30E mRNA	CTD	PMID:30851411
aflatoxin B1	decreases expression	ISO	RGD:2325460	6480464	Aflatoxin B1 results in decreased expression of MIR30E mRNA	CTD	PMID:24472605
all-trans-retinoic acid	multiple interactions	ISO	RGD:1354313	6480464	[Tretinoin co-treated with Phenylbutyrates co-treated with 1-hydroxy-2-oxo-3, 3-bis(2-aminoethyl)-1-triazene] results in increased expression of MIR30E mRNA	CTD	PMID:23284745
bis(2-chloroethyl) sulfide	decreases expression	EXP		6480464	Mustard Gas results in decreased expression of MIR30E mRNA	CTD	PMID:26456178
bis(2-ethylhexyl) phthalate	affects expression	ISO	RGD:2325460	6480464	Diethylhexyl Phthalate affects the expression of MIR30E mRNA	CTD	PMID:28192093
bisphenol A	increases methylation	ISO	RGD:2325460	6480464	bisphenol A results in increased methylation of MIR30E gene	CTD	PMID:28505145
bleomycin A2	decreases expression	ISO	RGD:2325460	6480464	Bleomycin results in decreased expression of MIR30E mRNA	CTD	PMID:25933445
cadmium dichloride	decreases expression	ISO	RGD:1354313	6480464	Cadmium Chloride results in decreased expression of MIR30E mRNA	CTD	PMID:30998937
cadmium dichloride	multiple interactions	ISO	RGD:1354313	6480464	MIR30E mRNA inhibits the reaction [Cadmium Chloride results in increased expression of SNAI1 mRNA], MIR30E mRNA inhibits the reaction [Cadmium Chloride results in increased expression of SNAI1 protein]	CTD	PMID:30998937
choline	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of MIR30E mRNA	CTD	PMID:20548288
cisplatin	increases expression	ISO	RGD:2325460	6480464	Cisplatin results in increased expression of MIR30E mRNA	CTD	PMID:24880025
cyclosporin A	decreases expression	ISO	RGD:1354313	6480464	Cyclosporine results in decreased expression of MIR30E mRNA	CTD	PMID:27989131
dibutyl phthalate	decreases expression	ISO	RGD:2325460	6480464	Dibutyl Phthalate results in decreased expression of MIR30E mRNA	CTD	PMID:30934153
folic acid	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of MIR30E mRNA	CTD	PMID:20548288
hydrogen peroxide	increases expression	ISO	RGD:1354313	6480464	Hydrogen Peroxide results in increased expression of MIR30E mRNA	CTD	PMID:26339600
icariin	increases expression	EXP		6480464	icariin results in increased expression of MIR30E mRNA	CTD	PMID:30533443
L-methionine	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of MIR30E mRNA	CTD	PMID:20548288
methapyrilene	affects expression	ISO	RGD:2325460	6480464	Methapyrilene affects the expression of MIR30E mRNA	CTD	PMID:24863736
paracetamol	increases expression	ISO	RGD:2325460	6480464	Acetaminophen results in increased expression of MIR30E mRNA	CTD	PMID:27397436
paracetamol	increases expression	EXP		6480464	Acetaminophen results in increased expression of MIR30E mRNA	CTD	PMID:19246379
progesterone	decreases expression	ISO	RGD:1354313	6480464	Progesterone results in decreased expression of MIR30E mRNA	CTD	PMID:22950660
quartz	decreases expression	ISO	RGD:2325460	6480464	Quartz results in decreased expression of MIR30E mRNA	CTD	PMID:23208435
rac-lactic acid	increases expression	ISO	RGD:1354313	6480464	Lactic Acid results in increased expression of MIR30E mRNA	CTD	PMID:30851411
resveratrol	increases expression	EXP		6480464	resveratrol results in increased expression of MIR30E mRNA	CTD	PMID:25280562
resveratrol	decreases expression	ISO	RGD:1354313	6480464	resveratrol results in decreased expression of MIR30E mRNA	CTD	PMID:20637737
sodium arsenite	increases expression	ISO	RGD:1354313	6480464	sodium arsenite results in increased expression of MIR30E mRNA	CTD	PMID:27054085, PMID:29207610
sodium fluoride	increases expression	EXP		6480464	Sodium Fluoride results in increased expression of MIR30E mRNA	CTD	PMID:29127033
tetrachloromethane	decreases expression	EXP		6480464	Carbon Tetrachloride results in decreased expression of MIR30E mRNA	CTD	PMID:25912033
thalidomide	decreases expression	EXP		6480464	Thalidomide results in decreased expression of MIR30E mRNA	CTD	PMID:26217789
zinc atom	decreases expression	ISO	RGD:2325460	6480464	Zinc deficiency results in decreased expression of MIR30E mRNA	CTD	PMID:22689922
zinc(0)	decreases expression	ISO	RGD:2325460	6480464	Zinc deficiency results in decreased expression of MIR30E mRNA	CTD	PMID:22689922

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to amino acid stimulus		IDA		2290270	(MGI:MGI:4833768, PMID:20548288)	MGI	MGI:MGI:4833768, PMID:20548288
cellular response to ethanol		IEP		2290270	(MGI:MGI:3835907, PMID:19091803)	MGI	MGI:MGI:3835907, PMID:19091803
cellular response to forskolin		IEP		2290270	(MGI:MGI:5305371, PMID:21993888)	MGI	MGI:MGI:5305371, PMID:21993888
cellular response to inorganic substance		IDA		2290270	(MGI:MGI:5305371, PMID:21993888)	MGI	MGI:MGI:5305371, PMID:21993888
long-term synaptic potentiation		IEP		2290270	(MGI:MGI:5645435, PMID:25858512)	MGI	MGI:MGI:5645435, PMID:25858512
response to bacterium		IEP		2290270	(MGI:MGI:5566744, PMID:24205035)	MGI	MGI:MGI:5566744, PMID:24205035
response to oxygen levels		IDA		2290270	(MGI:MGI:3842072, PMID:19188439)	MGI	MGI:MGI:3842072, PMID:19188439

Disease Annotations

	Experimental Liver Neoplasms (ISO)
	Hearing Loss, Noise-Induced (ISO)

Neoplasm Metastasis (ISO)

Gene-Chemical Interaction Annotations

	1,3,5-trinitro-1,3,5-triazinane (EXP)
	2,3,7,8-tetrachlorodibenzodioxine (ISO)
	2-(2,6-dioxopiperidin-3-yl)-1H-isoindole-1,3(2H)-dione (EXP)
	2-hydroxypropanoic acid (ISO)
	aflatoxin B1 (ISO)
	all-trans-retinoic acid (ISO)
	bis(2-chloroethyl) sulfide (EXP)
	bis(2-ethylhexyl) phthalate (ISO)
	bisphenol A (ISO)
	bleomycin A2 (ISO)
	cadmium dichloride (ISO)

	choline (EXP)
	cisplatin (ISO)
	cyclosporin A (ISO)
	dibutyl phthalate (ISO)
	folic acid (EXP)
	hydrogen peroxide (ISO)
	icariin (EXP)
	L-methionine (EXP)
	methapyrilene (ISO)
	paracetamol (EXP,ISO)
	progesterone (ISO)

	quartz (ISO)
	rac-lactic acid (ISO)
	resveratrol (EXP,ISO)
	sodium arsenite (ISO)
	sodium fluoride (EXP)
	tetrachloromethane (EXP)
	thalidomide (EXP)
	zinc atom (ISO)
	zinc(0) (ISO)

Gene Ontology Annotations

Biological Process

	cellular response to amino acid stimulus (IDA)
	cellular response to ethanol (IEP)
	cellular response to forskolin (IEP)
	cellular response to inorganic substance (IDA)

	long-term synaptic potentiation (IEP)
	response to bacterium (IEP)
	response to oxygen levels (IDA)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

12007417 12919684 15538371 16381832 16766679 17369397 17604727 18452032 19091803 19185580 19188439 19229884 20215419 20413612 20548288 21037258 21267068 21822254 21993888 22144232 22512273 22570807 22854828 23515048 24113179 24205035 25678587 25858512 26786283 27974319 28338991 28733476 29274035 30816428

Genomics

Comparative Map Data

Mir30e
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	4	120,772,606 - 120,772,697 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	4	120,445,211 - 120,445,302 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	4	119,490,804 - 119,490,895 (-)	NCBI		Celera
Cytogenetic Map	4	D2.2	NCBI

MIR30E
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	40,754,355 - 40,754,446 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	1	41,220,027 - 41,220,118 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	1	40,992,613 - 40,992,704 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	1	39,502,227 - 39,502,318 (+)	NCBI
Cytogenetic Map	1	p34.2	NCBI
HuRef	1	39,338,148 - 39,338,239 (+)	NCBI		HuRef
CHM1_1	1	41,335,858 - 41,335,949 (+)	NCBI		CHM1_1

Mir30e
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	5	139,702,872 - 139,702,963 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	5	139,702,872 - 139,702,963 (-)	Ensembl
Rnor_5.0	5	143,497,752 - 143,497,843 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	5	132,906,563 - 132,906,654 (-)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

MIR30E
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	15	2,283,306 - 2,283,369 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	15		NCBI

MIR30E
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1	6	170,429,841 - 170,429,920 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	6	157,476,655 - 157,476,734 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3
Pig Cytomap	6		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
14746982	Manh56_m	mandible shape 56 (mouse)					4	118088606	152088606	Mouse
1301823	Bmd7_m	bone mineral density 7 (mouse)			Not determined		4	89063832	151570093	Mouse
12910808	Pwbwq9_m	post-weaning body weight QTL 9 (mouse)					4	105978113	141706527	Mouse
10047132	Albq19_m	albuminuria QTL 19 (mouse)			Not determined		4	112930596	146930596	Mouse
4142493	Femwf13_m	femur work to failure 13 (mouse)			Not determined			116427367	150427471	Mouse
1300689	Dob1_m	Dietary obesity 1 (mouse)			Body weight		4	101717404	123233418	Mouse
13208562	Wght7_m	weight 7 (mouse)					4	91000000	148000000	Mouse
1300839	Dyscalc2_m	dystrophic cardiac calcinosis 2 (mouse)			Not determined		4	111115258	145115487	Mouse
4141900	Skts-fp1_m	skin tumor susceptibility in FVB and PWK 1 (mouse)			Not determined		4	53550839	124161387	Mouse
4141001	Tgq17_m	triglyceride QTL 17 (mouse)			Not determined			112629696	146629696	Mouse
11532714	Sluc43_m	susceptibility to lung cancer 43 (mouse)					4	46642108	123233418	Mouse
4141093	W3q17_m	weight 3 weeks QTL 17 (mouse)			Not determined			89063832	140740892	Mouse
1301597	Anxty_m	anxiety (mouse)			Not determined		4	74219337	128115487	Mouse
14696689	Gdq2_m	grooming duration QTL 2, females (mouse)					4	101000000	125000000	Mouse
1301731	Cafq2_m	caffeine metabolism QTL 2 (mouse)			Not determined		4	94875058	128875257	Mouse
1300743	Skull6_m	skull morphology 6 (mouse)			Not determined		4	111115258	145115487	Mouse
1301233	Sbw2_m	splenomegaly-NZB x NZW 2 (mouse)			Not determined		4	95069342	128115487	Mouse
1301106	Skts7_m	skin tumor susceptibility 7 (mouse)			Not determined		4	100214774	134215009	Mouse
1300918	Stheal4_m	soft tissue heal 4 (mouse)			Not determined		4	90112430	124112550	Mouse
4141330	Iva1_m	isovaleric acid smelling 1 (mouse)			Not determined			117214774	120866006	Mouse
10755522	Hgb1_m	hemoglobin 1 (mouse)					4	108583899	142583899	Mouse
1357800	Tgq3_m	triglyceride QTL 3 (mouse)			Not determined		4	107161300	141161387	Mouse
10755520	Rbc1_m	red blood cell count 1 (mouse)					4	108583899	142583899	Mouse
4141549	W10q10_m	weight 10 weeks QTL 10 (mouse)			Not determined			89063832	140740892	Mouse
10412072	Ssen1_m	suseptibility to Sendai virus 1 (mouse)			Not determined		4	109800935	133427471	Mouse
1301847	Fecq2_m	fecundity QTL 2 (mouse)			Not determined		4	100214774	134215009	Mouse
1357895	Ctrcts_m	cataract severity (mouse)			Not determined		4	45709925	138615442	Mouse
12903992	Opfaq6_m	open field activity QTL 6 (mouse)					4	119207798	121509300	Mouse
1301996	Mmtg2_m	modifier of mammary tumor growth 2 (mouse)			Not determined		4	116413782	124161387	Mouse
1300580	Lbw2_m	lupus NZB x NZW 2 (mouse)			Not determined		4	98657302	128115487	Mouse
1357529	Lvrq8_m	liver weight QTL 8 (mouse)			Not determined		4	89063832	140740892	Mouse
4141623	W6q13_m	weight 6 weeks QTL 13 (mouse)			Not determined			89063832	140740892	Mouse
1301815	Sles2_m	systemic lupus erythmatosus suppressor 2 (mouse)			Not determined		4	95069342	150592401	Mouse
1300781	Lith8_m	lithogenic gene 8 (mouse)			Not determined		4	107371164	141371360	Mouse
12910813	Pwbwq4_m	pre-weaning body weight QTL 4 (mouse)					4	105978113	141706527	Mouse
1301382	Arvm2_m	autoimmune renal vasculitis 2 (mouse)			Not determined		4	107897771	141897963	Mouse
1300663	Start2_m	startle response 2 (mouse)			Not determined		4	107371164	141371360	Mouse
1302102	Bis1_m	beta-carboline-induced seizures 1 (mouse)			Not determined		4	120137122	154137225	Mouse
12904002	Opfaq9_m	open field activity QTL 9 (mouse)					4	93118593	127118593	Mouse
11553870	Cmmm_m	carcinoma modifier of MSM (mouse)					4	90733471	124733584	Mouse
11567249	Elorr3_m	ethanol induced loss of righting response 3 (mouse)					4	3722677	156183778	Mouse
12910797	Pwgrq4_m	pre-weaning growth rate QTL 4 (mouse)					4	105978113	141706527	Mouse
10755521	Hct1_m	hematocrit 1 (mouse)					4	108583899	142583899	Mouse
1300809	Ccrs2_m	corpus callosum hemisphere surface size 2 (mouse)			Not determined		4	107371164	141371360	Mouse
1302078	Sluc21_m	susceptibility to lung cancer 21 (mouse)			Not determined		4	117673830	151673964	Mouse
12880433	Fgf23lq1_m	FGF23 serum level QTL 1 (mouse)					4	101300000	135300000	Mouse
1301964	Bw8q2_m	body weight at 8 weeks QTL 2 (mouse)			Not determined		4	120137122	154137225	Mouse
13208565	Bmiq6_m	body mass index QTL 6 (mouse)					4	111000000	126000000	Mouse
12910794	Pwbwq8_m	post-weaning body weight QTL 8 (mouse)					4	105978113	141706527	Mouse
1300655	Nidds_m	non-insulin-dependent diabetes mellitus in SJL (mouse)			Not determined		4	115173580	129572122	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Nfkbia	mmu-miR-30e-3p	OncomiRDB	external_info	NA	NA	22156201
Helz	mmu-miR-30e-3p	OncomiRDB	external_info	NA	NA	21963845
Ucp2	mmu-miR-30e-5p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot	Functional MTI	23515048
Slc35e1	mmu-miR-30e-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Sfmbt1	mmu-miR-30e-5p	Tarbase	external_info	Sequencing	POSITIVE
Myb	mmu-miR-30e-5p	OncomiRDB	external_info	NA	NA	21187425
Ube2i	mmu-miR-30e-5p	OncomiRDB	external_info	NA	NA	20498642
Ube2i	mmu-miR-30e-5p	OncomiRDB	external_info	NA	NA	19223510

Predicted Targets

	Summary Value
Count of predictions:	23484
Count of gene targets:	8705
Count of transcripts:	14648
Interacting mature miRNAs:	mmu-miR-30e-3p, mmu-miR-30e-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029602	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL606904	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608335	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029602

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	4	120,772,606 - 120,772,697 (-)	ENTREZGENE
MGSCv37	4	120,445,211 - 120,445,302 (-)	RGD
Celera	4	119,490,804 - 119,490,895 (-)	RGD
cM Map	4		ENTREZGENE

Sequence:

show sequence

GGGCAGTCTTTGCTACTGTAAACATCCTTGACTGGAAGCTGTAAGGTGTTGAGAGGAGCTTTCA
GTCGGATGTTTACAGCGGCAGGCTGCCA

hide sequence

Promoters

RGD ID:

6884494

Promoter ID:

EPDNEW_M5698

Type:

single initiation site

Name:

Mir30e_1

Description:

Mus musculus microRNA 30e , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	4	120,772,616 - 120,772,676	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065409	ENTREZGENE
Ensembl Transcript	ENSMUST00000083475	ENTREZGENE
MGD	MGI:3619329	ENTREZGENE
miRBase	MI0000259	ENTREZGENE
NCBI Gene	723836	ENTREZGENE
PhenoGen	Mir30e	PhenoGen
RNAcentral	URS00001DE669	RNACentral
	URS00004DC6A5	RNACentral
	URS0000759D99	RNACentral

More on Mir30e
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608216
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-01
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.