Mir346 (microRNA 346) - Rat Genome Database

Name: Mir346
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir346 (microRNA 346) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir346

Name:

microRNA 346

Description:

Involved in cellular response to amino acid stimulus. Is expressed in gut and pancreas.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-346; Mirn346; mmu-mir-346

Orthologs:

Homo sapiens (human) : MIR346 (microRNA 346) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir346 (microRNA 346) Alliance
Canis lupus familiaris (dog) : MIR346 (microRNA mir-346)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR346 (microRNA 346)	HGNC	HGNC
Rattus norvegicus (Norway rat):	Mir346 (microRNA 346)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR346 (microRNA mir-346)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	14	34,894,609 - 34,894,706 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	14	35,707,795 - 35,707,892 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	14	31,153,100 - 31,153,197 (+)	NCBI		Celera
Cytogenetic Map	14	B	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
adult respiratory distress syndrome		ISO	RGD:1352152	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:25070658
Disease Progression		ISO	RGD:1352152	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27777383
lung non-small cell carcinoma		ISO	RGD:1352152	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27777383
Myocardial Reperfusion Injury		ISO	RGD:1352152	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22050707
Neoplasm Invasiveness		ISO	RGD:1352152	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27501413, PMID:27777383
Neoplasm Metastasis		ISO	RGD:1352152	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27501413, PMID:27777383

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
17beta-estradiol	multiple interactions	ISO	RGD:1352152	6480464	[Progesterone co-treated with Estradiol] results in increased expression of MIR346 mRNA	CTD	PMID:22950660
arsenite(3-)	increases methylation	ISO	RGD:1352152	6480464	arsenite results in increased methylation of MIR346 promoter	CTD	PMID:23974009
benzo[a]pyrene	decreases expression	EXP		6480464	Benzo(a)pyrene results in decreased expression of MIR346 mRNA	CTD	PMID:22548065
choline	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR346 mRNA	CTD	PMID:20548288
folic acid	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR346 mRNA	CTD	PMID:20548288
L-methionine	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR346 mRNA	CTD	PMID:20548288
progesterone	multiple interactions	ISO	RGD:1352152	6480464	[Progesterone co-treated with Estradiol] results in increased expression of MIR346 mRNA	CTD	PMID:22950660
progesterone	increases expression	ISO	RGD:1352152	6480464	Progesterone results in increased expression of MIR346 mRNA	CTD	PMID:22950660
tetrachloromethane	increases expression	ISO	RGD:2325402	6480464	Carbon Tetrachloride results in increased expression of MIR346 mRNA	CTD	PMID:22112502
vinclozolin	increases expression	ISO	RGD:2325402	6480464	vinclozolin results in increased expression of MIR346 mRNA	CTD	PMID:23034163
vinclozolin	decreases expression	ISO	RGD:2325402	6480464	vinclozolin results in decreased expression of MIR346 mRNA	CTD	PMID:23869203

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to amino acid stimulus		IDA		2290270	(MGI:MGI:4833768, PMID:20548288)	MGI	MGI:MGI:4833768, PMID:20548288

Disease Annotations

	adult respiratory distress syndrome (ISO)
	Disease Progression (ISO)
	lung non-small cell carcinoma (ISO)

	Myocardial Reperfusion Injury (ISO)
	Neoplasm Invasiveness (ISO)
	Neoplasm Metastasis (ISO)

Gene-Chemical Interaction Annotations

	17beta-estradiol (ISO)
	arsenite(3-) (ISO)
	benzo[a]pyrene (EXP)
	choline (EXP)

	folic acid (EXP)
	L-methionine (EXP)
	progesterone (ISO)
	tetrachloromethane (ISO)

vinclozolin (ISO)

Gene Ontology Annotations

Biological Process

cellular response to amino acid stimulus (IDA)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

14691248 16381832 17369397 17936263 19727952 19780716 20215419 20413612 20548288 21037258 21267068 21822254 25661065

Genomics

Comparative Map Data

Mir346
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	14	34,894,609 - 34,894,706 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	14	35,707,795 - 35,707,892 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	14	31,153,100 - 31,153,197 (+)	NCBI		Celera
Cytogenetic Map	14	B	NCBI

MIR346
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	10	86,264,694 - 86,264,788 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	10	88,024,451 - 88,024,545 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	10	88,014,430 - 88,014,524 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	10	82,019,715 - 82,019,809 (-)	NCBI
Cytogenetic Map	10	q23.2	NCBI
HuRef	10	81,873,792 - 81,873,886 (-)	NCBI		HuRef
CHM1_1	10	88,306,192 - 88,306,286 (-)	NCBI		CHM1_1

Mir346
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	16	11,250,054 - 11,250,151 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	16	11,250,054 - 11,250,151 (+)	Ensembl
Rnor_5.0	16	9,574,933 - 9,575,030 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	16	5,002,049 - 5,002,146 (-)	NCBI		Celera
Cytogenetic Map	16	p15	NCBI

MIR346
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	4	34,073,335 - 34,073,429 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	4		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301991	Wta3_m	weight adult 3 (mouse)			Not determined		14	3837405	37837582	Mouse
4141550	Dbm3_m	diabetes modifier 3 (mouse)			Not determined			5093405	39093528	Mouse
1300779	Dyscalc4_m	dystrophic cardiac calcinosis 4 (mouse)			Not determined		14	12490914	46491050	Mouse
4141864	Mrdq4_m	modifier of retinal degeneration QTL 4 (mouse)			Not determined			12546018	48527625	Mouse
1300544	Hypn_m	hyperinsulinemia (mouse)			Not determined		14	15438659	49438808	Mouse
1301372	Sluc13_m	susceptibility to lung cancer 13 (mouse)			Not determined		14	19105647	53105769	Mouse
1357589	Kdnw2_m	kidney weight 2 (mouse)			Not determined		14	20837405	121032392	Mouse
1357527	Epfpq1_m	epididymal fat percentage QTL 1 (mouse)			Not determined		14	21012382	71648361	Mouse
14746973	Manh76_m	mandible shape 76 (mouse)					14	22565260	56565260	Mouse
4142485	Modor2_m	modifier of ocular retardation 2 (mouse)			Not determined		14	24925824	57942312	Mouse
13506929	Recrq10_m	recombination rate in male meiosis QTL 10 (mouse)					14	28200000	60900000	Mouse
10043886	Cia49_m	collagen induced arthritis QTL 49 (mouse)			Not determined		14	29759537	63759676	Mouse
1300998	Cia17_m	collagen induced arthritis 17 (mouse)			Not determined		14	30097793	64097924	Mouse
1300909	Ath13_m	atherosclerosis 13 (mouse)			Not determined		14	30097793	64097924	Mouse
14696688	Rfq2_m	rearing frequency QTL 2, males (mouse)					14	34000000	36000000	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Nrip1	mmu-miR-346-5p	Mirtarbase	external_info	Immunoblot//LacZ reporter assay//Quantitative prot	Functional MTI	19780716
Nrip1	mmu-miR-346-3p	Mirecords	external_info	{unchanged}	NA	19780716

Predicted Targets

	Summary Value
Count of predictions:	52876
Count of gene targets:	15673
Count of transcripts:	34278
Interacting mature miRNAs:	mmu-miR-346-3p, mmu-miR-346-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029774	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC154388	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CT030647	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608603	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029774

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	14	34,894,609 - 34,894,706 (+)	ENTREZGENE
MGSCv37	14	35,707,795 - 35,707,892 (+)	RGD
Celera	14	31,153,100 - 31,153,197 (+)	RGD
cM Map	14		ENTREZGENE

Sequence:

show sequence

TCTGTGTTGGGCGTCTGTCTGCCCGAGTGCCTGCCTCTCTGTTGCTCTGAAGGAGGCAGGGGCT
GGGCCTGCAGCTGCCTGGGCAGAGCTGCTCCTTC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065481	ENTREZGENE
Ensembl Transcript	ENSMUST00000083547	ENTREZGENE
MGD	MGI:3619362	ENTREZGENE
miRBase	MI0000634	ENTREZGENE
NCBI Gene	723847	ENTREZGENE
PhenoGen	Mir346	PhenoGen
RNAcentral	URS00002FAF0F	RNACentral
	URS00004BDA6B	RNACentral
	URS00006D2133	RNACentral

More on Mir346
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608207
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-01
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.