Mir425 (microRNA 425) - Rat Genome Database

Name: Mir425
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir425 (microRNA 425) Mus musculus

Analyze

Symbol:

Mir425

Name:

microRNA 425

RGD ID:

1608190

MGI Page

MGI

Description:

Involved in cellular response to amino acid stimulus; cellular response to lipopolysaccharide; and long-term synaptic potentiation. Orthologous to human MIR425 (microRNA 425).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

Mirn; Mirn425; mmu-mir-4; mmu-mir-425

RGD Orthologs

Human

Rat

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	108,445,976 - 108,446,060 (+)	NCBI	GRCm39		mm39
GRCm38	9	108,568,777 - 108,568,861 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	108,568,777 - 108,568,861 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	108,471,108 - 108,471,192 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	9	108,180,018 - 108,180,102 (+)	NCBI		Celera
Cytogenetic Map	9	F2	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

adenoma (ISO)

pulmonary fibrosis (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,4-dichlorobenzene (EXP)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2,2',4,4'-Tetrabromodiphenyl ether (EXP)

3-methylcholanthrene (EXP)

aflatoxin B1 (ISO)

arsane (ISO)

arsenic atom (ISO)

atrazine (ISO)

biphenyl-4-amine (ISO)

bis(2-ethylhexyl) phthalate (EXP,ISO)

bleomycin A2 (ISO)

choline (EXP)

folic acid (EXP)

formaldehyde (ISO)

hexanal (ISO)

hydrogen peroxide (ISO)

L-methionine (EXP)

methylisothiazolinone (ISO)

N-ethyl-N-nitrosourea (EXP)

nitrogen dioxide (EXP)

paracetamol (ISO)

progesterone (ISO)

sodium arsenite (ISO)

sulfur dioxide (EXP)

titanium dioxide (EXP)

trichloroethene (EXP)

valproic acid (EXP)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (IDA)

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

Phenotype Annotations Click to see Annotation Detail View

Mammalian Phenotype

impaired behavioral response to xenobiotic (IAGP)

increased susceptibility to dopaminergic neuron neurotoxicity (IAGP)

increased tumor necrosis factor secretion (IAGP)

loss of dopaminergic neurons (IAGP)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:15538371	PMID:16381832	PMID:17369397	PMID:17604727	PMID:18762567	PMID:19883498	PMID:20215419	PMID:20413612	PMID:20548288	PMID:21267068	PMID:25858512	PMID:29331376
PMID:29535266	PMID:30822529	PMID:31383850	PMID:32002587

Genomics

Comparative Map Data

Mir425
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	108,445,976 - 108,446,060 (+)	NCBI	GRCm39		mm39
GRCm38	9	108,568,777 - 108,568,861 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	108,568,777 - 108,568,861 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	108,471,108 - 108,471,192 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	9	108,180,018 - 108,180,102 (+)	NCBI		Celera
Cytogenetic Map	9	F2	NCBI

MIR425
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	3	49,020,148 - 49,020,234 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	3	49,020,148 - 49,020,234 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	3	49,057,581 - 49,057,667 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	3	49,032,584 - 49,032,670 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	3	49,014,304 - 49,014,390 (-)	NCBI
Cytogenetic Map	3	p21.31	NCBI
HuRef	3	49,115,446 - 49,115,532 (-)	NCBI		HuRef
CHM1_1	3	49,010,142 - 49,010,228 (-)	NCBI		CHM1_1

Mir425
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	8	117,354,821 - 117,354,903 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	8	117,354,821 - 117,354,903 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	8	116,699,324 - 116,699,406 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	8	108,560,329 - 108,560,411 (+)	NCBI		Celera
Cytogenetic Map	8	q32	NCBI

MIR425
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	20	40,144,606 - 40,144,683 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	20	40,144,613 - 40,144,675 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

MIR425
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	13	31,654,994 - 31,655,073 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	13	31,654,994 - 31,655,073 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	13	34,898,111 - 34,898,190 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Position Markers

AV253134

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	9	108,568,986 - 108,569,125	UniSTS	GRCm38
MGSCv37	9	108,471,317 - 108,471,456	UniSTS	GRCm37
Celera	9	108,180,227 - 108,180,366	UniSTS
Cytogenetic Map	9	F2	UniSTS
Whitehead/MRC_RH	9	1110.14	UniSTS

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301649	Psl1_m	promotion susceptibility QTL 1 (mouse)			Not determined		9	89412277	123412396	Mouse
1301732	Char1_m	P. chabaudi malaria resistance QTL 1 (mouse)			Not determined		9	81798268	115798392	Mouse
1301484	Bwq6_m	body weight (mouse)			Not determined		9	93762590	124595110	Mouse
1301487	Nociq1_m	nociceptive sensitivity inflammatory QTL 1 (mouse)			Not determined		9	84528818	118528921	Mouse
1301192	Skts6_m	skin tumor susceptibility 6 (mouse)			Not determined		9	78640645	112640755	Mouse
1302001	Bdln5_m	body length 5 (mouse)			Not determined		9	93762590	124595110	Mouse
1302065	El1_m	epilepsy 1 (mouse)			Not determined		9	75775364	114474379	Mouse
1302103	Dob2_m	dietary obesity 2 (mouse)			Not determined		9	86239845	120289624	Mouse
1301789	Pbwg4_m	postnatal body weight growth 4 (mouse)			Not determined		9	103289445	124595110	Mouse
1300884	Sluc11_m	susceptibility to lung cancer 11 (mouse)			Not determined		9	82910333	116910428	Mouse
1357627	Tgq2_m	triglyceride QTL 2 (mouse)			Not determined		9	102000187	124595110	Mouse
1357635	Splq4_m	spleen weight QTL 4 (mouse)			Not determined		9	63332429	120362868	Mouse
1357648	Obq18_m	obesity QTL 18 (mouse)			Not determined		9	102000187	124595110	Mouse
1357657	Pymr_m	Plasmodium yoelli malaria resistance (mouse)			Not determined		9	89977005	118938021	Mouse
4141545	Tailaq2_m	tail length adjusted QTL 2 (mouse)			Not determined			63332429	120362868	Mouse
1300549	Bbaa17_m	B. burgdorferi-associated arthritis 17 (mouse)			Not determined		9	86230401	120230530	Mouse
1558767	Skmw11_m	skeletal muscle weight 11 (mouse)			Not determined		9	91641084	124595110	Mouse
1301407	Rapop2_m	radiation-induced apoptosis 2 (mouse)			Not determined		9	76535936	110536130	Mouse
1301297	Lcho1_m	liver cholesterol 1 (mouse)			Not determined		9	101060861	124595110	Mouse
1357461	Idd2_m	insulin dependent diabetes susceptibility 2 (mouse)			Not determined		9	82910333	116910428	Mouse
10412290	Pvacm1l_m	plasma vascular cell adhesion molecule 1 levels (mouse)			Not determined		9	103289445	124595110	Mouse
10401247	Bglu14_m	blood glucose level 14 (mouse)			Not determined		9	79397810	113397888	Mouse
10054492	El7_m	epilepsy 7 (mouse)			Not determined		9	75775364	114474379	Mouse
10412180	Msam3_m	muscle, skeletal, activity measure 3 (mouse)			Not determined		9	85897510	108641186	Mouse
10412242	Alpq8_m	alcohol preference QTL 8 (mouse)			Not determined		9	89284925	123284925	Mouse
4141833	W10q13_m	weight 10 weeks QTL 13 (mouse)			Not determined			63332429	120362868	Mouse
12904947	Tammq7_m	tibialis anterior muscle mass QTL 7 (mouse)					9	91683173	124595110	Mouse
13463478	Mchq18_m	mean corpuscular hemoglobin QTL 18 (mouse)					9	91641084	124595110	Mouse
13207569	Tcq13_m	total cholesterol QTL 13 (mouse)					9	59990000	109260000	Mouse
13463474	Hbbcq5_m	hemoglobin concentration QTL 5 (mouse)					9	91641084	124595110	Mouse
12910772	Lvic6_m	liver iron content 6 (mouse)					9	91413879	124595110	Mouse
11081166	Psl5_m	promotion susceptibility QTL 5 (mouse)					9	94981301	112872929	Mouse
13463477	Rbc9_m	red blood cell count 9 (mouse)					9	91641084	124595110	Mouse
10766454	Char10_m	P. chabaudi malaria resistance QTL 10 (mouse)					9	82910333	116910428	Mouse
12904961	Gmmq7_m	gastrocnemius muscle mass QTL 7 (mouse)					9	91683173	124595110	Mouse
13463480	Mchcq2_m	mean corpuscular hemoglobin concentration QTL 2 (mouse)					9	91641084	124595110	Mouse
12910773	Splic3_m	spleen iron content 3 (mouse)					9	91413879	124595110	Mouse
12879896	Berr3_m	berghei resistance locus 3 (mouse)					9	103289445	124595110	Mouse
11537364	Cnes5_m	C. neoformans susceptibility locus 5 (mouse)					9	96917590	124595110	Mouse
14746992	Manh67_m	mandible shape 67 (mouse)					9	94036768	124595110	Mouse
18182932	Metl3_m	metabolite locus 3, N-acetylglutamate (mouse)					9	89563342	123563342	Mouse
11251716	Siim2_m	stress induced immobility 2 (mouse)					9	86748483	120748483	Mouse
12880422	V25Dq6_m	vitamin D inactive form serum level QTL 6 (mouse)					9	87800000	121800000	Mouse
12910770	Splic1_m	spleen iron content 1 (mouse)					9	91413879	124595110	Mouse
13463475	Hctq7_m	hematocrit QTL 7 (mouse)					9	91641084	124595110	Mouse
12904937	Edlmmq9_m	extensor digitorum longus muscle mass QTL 9 (mouse)					9	91683173	124595110	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Tmx4	mmu-miR-425-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Abca1	mmu-miR-425-5p	Tarbase	external_info	Sequencing	POSITIVE

Predicted Targets

	Summary Value
Count of predictions:	9410
Count of gene targets:	5032
Count of transcripts:	7768
Interacting mature miRNAs:	mmu-miR-425-3p, mmu-miR-425-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029947	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	CT010508	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083645

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	9	108,568,777 - 108,568,861 (+)	Ensembl

RefSeq Acc Id:

NR_029947

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	9	108,445,976 - 108,446,060 (+)	NCBI
GRCm38	9	108,568,777 - 108,568,861 (+)	ENTREZGENE
MGSCv37	9	108,471,108 - 108,471,192 (+)	RGD
Celera	9	108,180,018 - 108,180,102 (+)	RGD
cM Map	9		ENTREZGENE

Sequence:

show sequence

AAAGTGCTTTGGAATGACACGATCACTCCCGTTGAGTGGGCACCCAAGAAGCCATCGGGAATGT
CGTGTCCGCCCAGTGCTCTTT

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619401	AgrOrtholog
Ensembl Genes	ENSMUSG00000065579	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083645	ENTREZGENE
MGD	MGI:3619401	ENTREZGENE
miRBase	MI0001447	ENTREZGENE
NCBI Gene	723864	ENTREZGENE
PhenoGen	Mir425	PhenoGen
RNAcentral	URS00002895D7	RNACentral
	URS000048BA36	RNACentral
	URS00006EF746	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD