Mir429 (microRNA 429) - Rat Genome Database

Name: Mir429
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir429 (microRNA 429) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir429

Name:

microRNA 429

Description:

Involved in cellular response to amino acid stimulus and sensory perception of sound. Is expressed in metanephros; olfactory epithelium; and vomeronasal organ.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-429; Mirn429; mmu-mir-429

Orthologs:

Homo sapiens (human) : MIR429 (microRNA 429) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir429 (microRNA 429) Alliance

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR429 (microRNA 429)	HGNC	HGNC
Rattus norvegicus (Norway rat):	Mir429 (microRNA 429)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	4	156,053,905 - 156,053,987 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	4	155,428,014 - 155,428,096 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	4	158,316,301 - 158,316,383 (-)	NCBI		Celera
Cytogenetic Map	4	E2	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
congenital myasthenic syndrome 8		ISO	RGD:1605756	8554872	ClinVar Annotator: match by term: Myasthenic syndrome, congenital, 8	ClinVar	PMID:24951643, PMID:28492532
Goldberg-Shprintzen syndrome		ISO	RGD:1605756	8554872	ClinVar Annotator: match by term: Shprintzen-Goldberg syndrome	ClinVar	PMID:28492532
Neurodevelopmental Disorders		ISO	RGD:1605756	8554872	ClinVar Annotator: match by term: Neurodevelopmental disorder	ClinVar	PMID:25741868
Shprintzen Golberg Craniosynostosis		ISO	RGD:1605756	8554872	ClinVar Annotator: match by term: Shprintzen-Goldberg syndrome	ClinVar	PMID:28492532

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Breast Neoplasms		ISO	RGD:1605756	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:20099276
Experimental Liver Neoplasms		ISO	RGD:1605756	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:21035526
Hearing Loss, Noise-Induced		ISO	RGD:1605756	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23472202
Myocardial Reperfusion Injury		ISO	RGD:1605756	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22050707
pancreatitis		ISO	RGD:1605756	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27840954

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
1,3,5-trinitro-1,3,5-triazinane	decreases expression	EXP		6480464	cyclonite results in decreased expression of MIR429 mRNA	CTD	PMID:19270793
2-acetamidofluorene	increases expression	ISO	RGD:2325537	6480464	2-Acetylaminofluorene results in increased expression of MIR429 mRNA	CTD	PMID:19167416, PMID:22584684
aflatoxin B2	decreases methylation	ISO	RGD:1605756	6480464	aflatoxin B2 results in decreased methylation of MIR429 promoter	CTD	PMID:30157460
amphetamine	increases expression	ISO	RGD:2325537	6480464	Amphetamine results in increased expression of MIR429 mRNA	CTD	PMID:30779732
benzophenone	increases expression	ISO	RGD:2325537	6480464	benzophenone results in increased expression of MIR429 mRNA	CTD	PMID:22584684
bis(2-ethylhexyl) phthalate	increases expression	ISO	RGD:2325537	6480464	Diethylhexyl Phthalate results in increased expression of MIR429 mRNA	CTD	PMID:22584684
bleomycin A2	decreases expression	ISO	RGD:2325537	6480464	Bleomycin results in decreased expression of MIR429 mRNA	CTD	PMID:25933445
chlorendic acid	increases expression	ISO	RGD:2325537	6480464	chlorendic acid results in increased expression of MIR429 mRNA	CTD	PMID:22584684
choline	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR429 mRNA	CTD	PMID:20548288
cisplatin	affects response to substance	ISO	RGD:1605756	6480464	MIR429 promoter affects the susceptibility to Cisplatin	CTD	PMID:20099276
cisplatin	increases expression	ISO	RGD:2325537	6480464	Cisplatin results in increased expression of MIR429 mRNA	CTD	PMID:24880025
dioxygen	decreases cleavage	ISO	RGD:1605756	6480464	Oxygen deficiency results in decreased cleavage of MIR429 mRNA	CTD	PMID:25351418
dioxygen	decreases expression	ISO	RGD:1605756	6480464	Oxygen deficiency results in decreased expression of MIR429 mRNA modified form	CTD	PMID:25351418
dioxygen	multiple interactions	ISO	RGD:1605756	6480464	DICER1 protein inhibits the reaction [Oxygen deficiency results in decreased cleavage of MIR429 mRNA]	CTD	PMID:25351418
folic acid	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR429 mRNA	CTD	PMID:20548288
furan	increases expression	ISO	RGD:2325537	6480464	furan results in increased expression of MIR429 mRNA	CTD	PMID:22079235
icariin	increases expression	EXP		6480464	icariin results in increased expression of MIR429 mRNA	CTD	PMID:30533443
L-methionine	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR429 mRNA	CTD	PMID:20548288
paracetamol	increases expression	ISO	RGD:2325537	6480464	Acetaminophen results in increased expression of MIR429 mRNA	CTD	PMID:27397436
phenobarbital	increases expression	ISO	RGD:2325537	6480464	Phenobarbital results in increased expression of MIR429 mRNA	CTD	PMID:22584684
sodium arsenite	decreases expression	ISO	RGD:1605756	6480464	sodium arsenite results in decreased expression of MIR429 mRNA	CTD	PMID:21292642
sodium arsenite	increases methylation	ISO	RGD:1605756	6480464	sodium arsenite results in increased methylation of MIR429 promoter	CTD	PMID:21292642
tetrachloromethane	increases expression	ISO	RGD:2325537	6480464	Carbon Tetrachloride results in increased expression of MIR429 mRNA	CTD	PMID:27397436
triclosan	increases expression	ISO	RGD:1605756	6480464	Triclosan results in increased expression of MIR429 mRNA	CTD	PMID:30510588

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to amino acid stimulus		IDA		2290270	(MGI:MGI:4833768, PMID:20548288)	MGI	MGI:MGI:4833768, PMID:20548288
olfactory bulb interneuron differentiation		ISO	RefSeq:NC_000070.5	2290270	(MGI:MGI:3778596, PMID:18184563)	MGI	MGI:MGI:3778596, PMID:18184563
sensory perception of sound		IEP		2290270	(MGI:MGI:5508842, PMID:23646144)	MGI	MGI:MGI:5508842, PMID:23646144

Phenotype Annotations

Mammalian Phenotype

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
decreased circulating luteinizing hormone level		IAGP		5509061		MGI	PMID:23765281
decreased circulating progesterone level		IAGP		5509061		MGI	PMID:23765281
decreased corpora lutea number		IAGP		5509061		MGI	PMID:23765281
decreased litter size		IAGP		5509061		MGI	PMID:23765281
decreased luteinizing hormone level		IAGP		5509061		MGI	PMID:23765281
decreased oocyte number		IAGP		5509061		MGI	PMID:23765281
decreased ovulation rate		IAGP		5509061		MGI	PMID:23765281
prolonged estrus		IAGP		5509061		MGI	PMID:23765281
reduced female fertility		IAGP		5509061		MGI	PMID:23765281

Disease Annotations

	Breast Neoplasms (ISO)
	congenital myasthenic syndrome 8 (ISO)
	Experimental Liver Neoplasms (ISO)
	Goldberg-Shprintzen syndrome (ISO)

	Hearing Loss, Noise-Induced (ISO)
	Myocardial Reperfusion Injury (ISO)
	Neurodevelopmental Disorders (ISO)
	pancreatitis (ISO)

Shprintzen Golberg Craniosynostosis (ISO)

Gene-Chemical Interaction Annotations

	1,3,5-trinitro-1,3,5-triazinane (EXP)
	2-acetamidofluorene (ISO)
	aflatoxin B2 (ISO)
	amphetamine (ISO)
	benzophenone (ISO)
	bis(2-ethylhexyl) phthalate (ISO)
	bleomycin A2 (ISO)

	chlorendic acid (ISO)
	choline (EXP)
	cisplatin (ISO)
	dioxygen (ISO)
	folic acid (EXP)
	furan (ISO)
	icariin (EXP)

	L-methionine (EXP)
	paracetamol (ISO)
	phenobarbital (ISO)
	sodium arsenite (ISO)
	tetrachloromethane (ISO)
	triclosan (ISO)

Gene Ontology Annotations

Biological Process

	cellular response to amino acid stimulus (IDA)
	olfactory bulb interneuron differentiation (ISO)

sensory perception of sound (IEP)

Phenotype Annotations

Mammalian Phenotype

	decreased circulating luteinizing hormone level (IAGP)
	decreased circulating progesterone level (IAGP)
	decreased corpora lutea number (IAGP)
	decreased litter size (IAGP)

	decreased luteinizing hormone level (IAGP)
	decreased oocyte number (IAGP)
	decreased ovulation rate (IAGP)
	prolonged estrus (IAGP)

reduced female fertility (IAGP)

References - curated

1.	RGD automated import pipeline
2.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

15735639 16381832 17369397 17604727 18184563 18829540 20016822 20215419 20413612 20548288 21037258 21079000 21267068 21518438 23138483 23646144 23765281 24631216 25152461 25609238 25937343 26489013 26818658 27299781 27576955 27655719 28941704 29449309 29602800 29624520 30334065 30578296

Genomics

Comparative Map Data

Mir429
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	4	156,053,905 - 156,053,987 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	4	155,428,014 - 155,428,096 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	4	158,316,301 - 158,316,383 (-)	NCBI		Celera
Cytogenetic Map	4	E2	NCBI

MIR429
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	1,169,005 - 1,169,087 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	1	1,104,385 - 1,104,467 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	1	1,094,247 - 1,094,329 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	1	1,478,391 - 1,478,473 (-)	NCBI
Cytogenetic Map	1	p36.33	NCBI
HuRef	1	375,766 - 375,848 (+)	NCBI		HuRef
CHM1_1	1	1,091,357 - 1,091,439 (+)	NCBI		CHM1_1

Mir429
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	5	173,488,331 - 173,488,415 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	5	173,488,331 - 173,488,415 (-)	Ensembl
Rnor_5.0	5	176,962,353 - 176,962,437 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	5	164,848,262 - 164,848,346 (-)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
11567249	Elorr3_m	ethanol induced loss of righting response 3 (mouse)					4	3722677	156183778	Mouse
10755531	Lymph3_m	lymphocyte differential 3 (mouse)					4	124826172	156508116	Mouse
1301982	Pltiq1_m	phospholipid transfer protein inducibility QTL 1 (mouse)			Not determined		4	124893970	156508116	Mouse
1300858	Tafat_m	tally ho associated mesenteric fat pad weight (mouse)			Not determined		4	124893970	156508116	Mouse
4142139	Adip12_m	adiposity 12 (mouse)			Not determined		4	124893970	156508116	Mouse
1300933	Cdcs9_m	cytokine deficiency colitis susceptibility 9 (mouse)			Not determined		4	125504302	156508116	Mouse
10045620	Heal22_m	wound healing/regeneration 22 (mouse)			Not determined		4	125504302	156508116	Mouse
1300621	Tpnr1_m	thermal pain response 1 (mouse)			Not determined		4	125504302	156508116	Mouse
11533916	Mts1_m	mammary tumor susceptibility 1 (mouse)					4	125562755	156508116	Mouse
4142481	Gct1_m	granulosa cell tumorigenesis 1 (mouse)			Not determined		4	128057656	156508116	Mouse
10043996	Gct5_m	granulosa cell tumorigenesis 5 (mouse)			Not determined		4	128057656	156508116	Mouse
1300874	Gasa2_m	gastritis type A susceptibility locus 2 (mouse)			Not determined		4	132926037	156508116	Mouse
4142077	Ignpq2_m	IgA nephropathy QTL 2 (mouse)			Not determined		4	133592276	156508116	Mouse
1301108	Scon2_m	sucrose consumption 2 (mouse)			Not determined		4	134569994	156508116	Mouse
1300537	Ap3q_m	alcohol preference 3 QTL (mouse)			Not determined		4	134569994	156508116	Mouse
1300780	Cocrb16_m	cocaine related behavior 16 (mouse)			Not determined		4	138859268	156508116	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Zeb1	mmu-miR-429-3p	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	19745813
Zeb1	mmu-miR-429-3p	Mirtarbase	external_info	Reporter assay	Functional MTI	21049046
Zeb1	mmu-miR-429-3p	Mirtarbase	external_info	Reporter assay	Non-Functional MTI	18411277
Zeb2	mmu-miR-429-3p	Mirtarbase	external_info	Reporter assay	Functional MTI	18411277
Zeb2	mmu-miR-429-3p	Mirtarbase	external_info	Western blot//immunohistochemistry//Microarray//qR	Functional MTI	19167416
Flt1	mmu-miR-429-3p	Mirtarbase	external_info	Luciferase reporter assay	Non-Functional MTI	21115742
Zeb1	mmu-miR-429-3p	Tarbase	external_info	Reporter Gene	NEGATIVE
Sox2	mmu-miR-429-5p	OncomiRDB	external_info	NA	NA	23111103
Mybl2	mmu-miR-429-5p	OncomiRDB	external_info	NA	NA	22101269
Bcl2	mmu-miR-429-5p	OncomiRDB	external_info	NA	NA	21993663
Nol3	mmu-miR-429-5p	OncomiRDB	external_info	NA	NA	21684154
Zeb2	mmu-miR-429-3p	Tarbase	external_info	Reporter Gene	POSITIVE

Predicted Targets

	Summary Value
Count of predictions:	14572
Count of gene targets:	6592
Count of transcripts:	10706
Interacting mature miRNAs:	mmu-miR-429-3p, mmu-miR-429-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029958	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL627204	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609020	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029958

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	4	156,053,905 - 156,053,987 (-)	ENTREZGENE
MGSCv37	4	155,428,014 - 155,428,096 (-)	RGD
Celera	4	158,316,301 - 158,316,383 (-)	RGD
cM Map	4		ENTREZGENE

Sequence:

show sequence

CCTGCTGATGGATGTCTTACCAGACATGGTTAGATCTGGATGCATCTGTCTAATACTGTCTGGT
AATGCCGTCCATCCACGGC

hide sequence

Promoters

RGD ID:

6885860

Promoter ID:

EPDNEW_M6381

Type:

single initiation site

Name:

Mir429_1

Description:

Mus musculus microRNA 429 , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	4	156,053,914 - 156,053,974	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065427	ENTREZGENE
Ensembl Transcript	ENSMUST00000083493	ENTREZGENE
MGD	MGI:3619402	ENTREZGENE
miRBase	MI0001642	ENTREZGENE
NCBI Gene	723865	ENTREZGENE
PhenoGen	Mir429	PhenoGen
RNAcentral	URS00001BB658	RNACentral
	URS00002D8367	RNACentral
	URS000075AE5E	RNACentral

More on Mir429
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608189
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-29
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.