Mir7b (microRNA 7b) - Rat Genome Database

Name: Mir7b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir7b (microRNA 7b) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir7b

Name:

microRNA 7b

Description:

Involved in several processes, including cellular hyperosmotic salinity response; cellular response to leukemia inhibitory factor; and long-term synaptic potentiation. Is expressed in cerebellum; cerebral cortex; and embryo.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-7b; Mirn7b; mmu-mir-7b

Orthologs:

Homo sapiens (human) : MIR7-3 (microRNA 7-3) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir7b (microRNA 7b) Alliance
Canis lupus familiaris (dog) : MIR7-3 (microRNA mir-7-3)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR7-3 (microRNA 7-3)	HGNC	HGNC
Rattus norvegicus (Norway rat):	Mir7b (microRNA 7b)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR7-3 (microRNA mir-7-3)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	17	56,242,988 - 56,243,098 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	17	56,382,411 - 56,382,521 (+)	NCBI	GRCm37		mm9	NCBIm37
Cytogenetic Map	17	D	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
3-chloropropane-1,2-diol	increases expression	EXP		6480464	alpha-Chlorohydrin analog results in increased expression of MIR7B mRNA	CTD	PMID:29860048
hexanal	decreases expression	ISO	RGD:2325434	6480464	n-hexanal results in decreased expression of MIR7B mRNA	CTD	PMID:26403475

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular hyperosmotic salinity response		IDA		2290270	(MGI:MGI:3691268, PMID:17028171)	MGI	MGI:MGI:3691268, PMID:17028171
cellular response to leukemia inhibitory factor		IEP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
cellular response to lipopolysaccharide		IDA		2290270	(MGI:MGI:5050043, PMID:21247879)	MGI	MGI:MGI:5050043, PMID:21247879
long-term synaptic potentiation		IEP		2290270	(MGI:MGI:5645435, PMID:25858512)	MGI	MGI:MGI:5645435, PMID:25858512
negative regulation of translation		IDA		2290270	(MGI:MGI:3691268, PMID:17028171)	MGI	MGI:MGI:3691268, PMID:17028171

Phenotype Annotations

Mammalian Phenotype

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
no abnormal phenotype detected		IAGP		5509061		MGI	PMID:29887379

Gene-Chemical Interaction Annotations

3-chloropropane-1,2-diol (EXP)

hexanal (ISO)

Gene Ontology Annotations

Biological Process

	cellular hyperosmotic salinity response (IDA)
	cellular response to leukemia inhibitory factor (IEP)
	cellular response to lipopolysaccharide (IDA)

	long-term synaptic potentiation (IEP)
	negative regulation of translation (IDA)

Phenotype Annotations

Mammalian Phenotype

no abnormal phenotype detected (IAGP)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

12624257 16369549 16381832 17028171 17369397 17604727 20215419 20413612 20439489 21037258 21247879 21267068 21822254 22570807 23223022 24039126 24813889 25123438 25858512 28218624 28798046 29887379 30578296

Genomics

Comparative Map Data

Mir7b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	17	56,242,988 - 56,243,098 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	17	56,382,411 - 56,382,521 (+)	NCBI	GRCm37		mm9	NCBIm37
Cytogenetic Map	17	D	NCBI

MIR7-3
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	4,770,670 - 4,770,779 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	19	4,770,682 - 4,770,791 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	4,721,681 - 4,721,790 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	19	4,708,560 - 4,708,669 (+)	NCBI
Cytogenetic Map	19	p13.3	NCBI
HuRef	19	4,532,713 - 4,532,822 (+)	NCBI		HuRef
CHM1_1	19	4,770,264 - 4,770,373 (+)	NCBI		CHM1_1

Mir7b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	9	10,812,432 - 10,812,541 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	9	10,812,432 - 10,812,541 (-)	Ensembl
Rnor_5.0	9	9,803,905 - 9,804,014 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	7,429,591 - 7,429,700 (-)	NCBI		Celera
Cytogenetic Map	9	q12	NCBI

MIR7-3
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	20	54,993,200 - 54,993,287 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	20		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4141272	Tfv1_m	total food volume 1 (mouse)			Not determined			4804477	65330362	Mouse
1301338	Lmr1_m	leishmaniasis resistance 1 (mouse)			Not determined		17	9862411	86688972	Mouse
4142150	Stheal11_m	soft tissue heal 11 (mouse)			Not determined		17	12067324	83054339	Mouse
1301454	Eae5_m	susceptibility to experimental allergic encephalomyelitis 5 (mouse)			Not determined		17	24301859	58301973	Mouse
10412204	Bbaa29_m	B.burgdorferi-associated arthritis 29 (mouse)			Not determined		17	25740294	59740461	Mouse
1302005	Loco2_m	locomotor activity 2 (mouse)			Not determined		17	26574081	60574223	Mouse
1300703	Uvbi2_m	UVB induced immunosuppression 2 (mouse)			Not determined		17	28311480	62311728	Mouse
1300589	Myaa2_m	modifier of Yaa 2 (mouse)			Not determined		17	29821629	63821740	Mouse
4140955	Plgr1_m	plague resistance locus 1 (mouse)			Not determined			30722575	64722705	Mouse
1300885	Mbis4_m	Mycobacterium bovis-induced systemic lupus erythematosus 4 (mouse)			Not determined		17	34956841	69858931	Mouse
10755514	Amzn2_m	anatomical modifier of Zfp423 2 (mouse)					17	35659266	69659396	Mouse
12904951	Smmq2_m	soleus muscle mass QTL 2 (mouse)					17	36482715	70482715	Mouse
1300592	Pcyts5_m	plasmacytoma susceptibility 5 (mouse)			Not determined		17	38405886	72405969	Mouse
10755525	Lymph2_m	lymphocyte differential 2 (mouse)					17	38498625	72498625	Mouse
10755534	Lymph4_m	lymphocyte differential 4 (mouse)					17	38498625	72498625	Mouse
4141319	Hmtb8_m	hemostasis and thrombosis rebleeding time 8 (mouse)			Not determined			40227447	74227623	Mouse
14700692	Cihvtq1_m	coxsackieviral infection heart viral titre QTL 1 (mouse)					17	49700000	69700000	Mouse
1357754	Ahl3_m	age related hearing loss 3 (mouse)			Not determined		17	49896962	83897108	Mouse
4142243	Lfnq5_m	lung function QTL 5 (mouse)			Not determined			51431951	57227623	Mouse
1357532	Bmch7_m	bone mechanical trait 7 (mouse)			Not determined		17	51451430	85451617	Mouse
4141879	Chlq9_m	circulating hormone level QTL 9 (mouse)			Not determined		17	51451430	85451617	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Fos	mmu-miR-7b-5p	Mirtarbase	external_info	Luciferase reporter assay//Microarray//Northern bl	Functional MTI	17028171
Soat1	mmu-miR-7b-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Fos	mmu-miR-7b-5p	Tarbase	external_info	Westernblit	POSITIVE
Slc39a12	mmu-miR-7b-5p	Tarbase	external_info	Sequencing	POSITIVE
Fos	mmu-miR-7b-3p	Mirecords	external_info	{unchanged}	NA	17028171

Predicted Targets

	Summary Value
Count of predictions:	21295
Count of gene targets:	8471
Count of transcripts:	14035
Interacting mature miRNAs:	mmu-miR-7b-3p, mmu-miR-7b-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029827	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC026385	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608657	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029827

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	17	56,242,988 - 56,243,098 (+)	ENTREZGENE
MGSCv37	17	56,382,411 - 56,382,521 (+)	RGD
cM Map	17		ENTREZGENE

Sequence:

show sequence

AGGAGCGGAGTACGTGAGCCAGTGCTATGTGGAAGACTTGTGATTTTGTTGTTCTGATATGATA
TGACAACAAGTCACAGCCAGCCTCATAGCGTGGACTCCTATCACCTT

hide sequence

Promoters

RGD ID:

13676496

Promoter ID:

EPDNEW_M22397

Type:

single initiation site

Name:

Mir7b_1

Description:

Mus musculus microRNA 7b , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	17	56,243,079 - 56,243,139	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065491	ENTREZGENE
Ensembl Transcript	ENSMUST00000083557	ENTREZGENE
MGD	MGI:3619435	ENTREZGENE
miRBase	MI0000730	ENTREZGENE
NCBI Gene	723883	ENTREZGENE
PhenoGen	Mir7b	PhenoGen
RNAcentral	URS0000224ED9	RNACentral
	URS00002D98BC	RNACentral
	URS000075AECB	RNACentral

More on Mir7b
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608173
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-29
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.