Mir7b (microRNA 7b) - Rat Genome Database

Name: Mir7b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir7b (microRNA 7b) Mus musculus

Analyze

Symbol:

Mir7b

Name:

microRNA 7b

RGD ID:

1608173

MGI Page

MGI

Description:

Is expressed in cerebellum; cerebral cortex; and embryo. Orthologous to human MIR7-3 (microRNA 7-3).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

Mir; mir-7b; Mirn7b; mmu-mir-; mmu-mir-7b

RGD Orthologs

Human

Rat

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	17	56,549,988 - 56,550,098 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	17	56,549,988 - 56,550,098 (+)	Ensembl
GRCm38	17	56,242,988 - 56,243,098 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	17	56,242,988 - 56,243,098 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	17	56,382,411 - 56,382,521 (+)	NCBI	GRCm37		mm9	NCBIm37
Cytogenetic Map	17	D	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

3-chloropropane-1,2-diol (EXP)

benzo[a]pyrene (ISO)

cadmium atom (EXP)

cadmium dichloride (EXP)

hexanal (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular hyperosmotic salinity response (IDA)

cellular response to leukemia inhibitory factor (IEP)

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

negative regulation of translation (IDA)

Phenotype Annotations Click to see Annotation Detail View

Mammalian Phenotype

no abnormal phenotype detected (IAGP)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:12624257	PMID:16369549	PMID:16381832	PMID:17028171	PMID:17369397	PMID:17604727	PMID:20215419	PMID:20413612	PMID:20439489	PMID:21037258	PMID:21247879	PMID:21267068
PMID:21822254	PMID:22570807	PMID:23223022	PMID:24039126	PMID:24813889	PMID:25123438	PMID:25858512	PMID:28218624	PMID:28798046	PMID:29887379	PMID:30548297	PMID:30578296

Genomics

Comparative Map Data

Mir7b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	17	56,549,988 - 56,550,098 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	17	56,549,988 - 56,550,098 (+)	Ensembl
GRCm38	17	56,242,988 - 56,243,098 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	17	56,242,988 - 56,243,098 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	17	56,382,411 - 56,382,521 (+)	NCBI	GRCm37		mm9	NCBIm37
Cytogenetic Map	17	D	NCBI

MIR7-3
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	19	4,770,670 - 4,770,779 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	19	4,770,670 - 4,770,779 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	19	4,770,682 - 4,770,791 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	4,721,681 - 4,721,790 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	19	4,708,560 - 4,708,669 (+)	NCBI
Cytogenetic Map	19	p13.3	NCBI
HuRef	19	4,532,713 - 4,532,822 (+)	NCBI		HuRef
CHM1_1	19	4,770,264 - 4,770,373 (+)	NCBI		CHM1_1

Mir7b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	9	1,080,274 - 1,080,383 (+)	NCBI
Rnor_6.0 Ensembl	9	10,812,432 - 10,812,541 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	9	10,812,432 - 10,812,541 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	9	9,803,905 - 9,804,014 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	7,429,591 - 7,429,700 (-)	NCBI		Celera
Cytogenetic Map	9	q12	NCBI

MIR7-3
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	20	54,993,200 - 54,993,287 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	20	54,993,200 - 54,993,287 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

MIR7-1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	1	191,218,565 - 191,218,648 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	1	191,218,565 - 191,218,648 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	1	212,651,386 - 212,651,469 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4141272	Tfv1_m	total food volume 1 (mouse)			Not determined			4804477	65330362	Mouse
1301338	Lmr1_m	leishmaniasis resistance 1 (mouse)			Not determined		17	9862411	86688972	Mouse
4142150	Stheal11_m	soft tissue heal 11 (mouse)			Not determined		17	12067324	83054339	Mouse
1301454	Eae5_m	susceptibility to experimental allergic encephalomyelitis 5 (mouse)			Not determined		17	24301859	58301973	Mouse
10412204	Bbaa29_m	B.burgdorferi-associated arthritis 29 (mouse)			Not determined		17	25740294	59740461	Mouse
1302005	Loco2_m	locomotor activity 2 (mouse)			Not determined		17	26574081	60574223	Mouse
15039348	Nmrs37_m	NAFLD-associated magnetic resonance shift 37 (mouse)					17	27504322	61504322	Mouse
1300703	Uvbi2_m	UVB induced immunosuppression 2 (mouse)			Not determined		17	28311480	62311728	Mouse
1300589	Myaa2_m	modifier of Yaa 2 (mouse)			Not determined		17	29821629	63821740	Mouse
4140955	Plgr1_m	plague resistance locus 1 (mouse)			Not determined			30722575	64722705	Mouse
1300885	Mbis4_m	Mycobacterium bovis-induced systemic lupus erythematosus 4 (mouse)			Not determined		17	34956841	69858931	Mouse
10755514	Amzn2_m	anatomical modifier of Zfp423 2 (mouse)					17	35659266	69659396	Mouse
12904951	Smmq2_m	soleus muscle mass QTL 2 (mouse)					17	36482715	70482715	Mouse
1300592	Pcyts5_m	plasmacytoma susceptibility 5 (mouse)			Not determined		17	38405886	72405969	Mouse
10755525	Lymph2_m	lymphocyte differential 2 (mouse)					17	38498625	72498625	Mouse
10755534	Lymph4_m	lymphocyte differential 4 (mouse)					17	38498625	72498625	Mouse
4141319	Hmtb8_m	hemostasis and thrombosis rebleeding time 8 (mouse)			Not determined			40227447	74227623	Mouse
15039324	Nmrs48_m	NAFLD-associated magnetic resonance shift 48 (mouse)					17	40632187	74632187	Mouse
26884390	Skwq9_m	skull length QTL 9, 10 week (mouse)					17	43400000	67500000	Mouse
26884428	Cvht3_m	cranial vault height 3, 5 week (mouse)					17	46200000	82100000	Mouse
14700692	Cihvtq1_m	coxsackieviral infection heart viral titre QTL 1 (mouse)					17	49700000	69700000	Mouse
1357754	Ahl3_m	age related hearing loss 3 (mouse)			Not determined		17	49896962	83897108	Mouse
4142243	Lfnq5_m	lung function QTL 5 (mouse)			Not determined			51431951	57227623	Mouse
1357532	Bmch7_m	bone mechanical trait 7 (mouse)			Not determined		17	51451430	85451617	Mouse
4141879	Chlq9_m	circulating hormone level QTL 9 (mouse)			Not determined		17	51451430	85451617	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Fos	mmu-miR-7b-5p	Mirtarbase	external_info	Luciferase reporter assay//Microarray//Northern bl	Functional MTI	17028171
Soat1	mmu-miR-7b-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Fos	mmu-miR-7b-5p	Tarbase	external_info	Westernblit	POSITIVE
Slc39a12	mmu-miR-7b-5p	Tarbase	external_info	Sequencing	POSITIVE
Fos	mmu-miR-7b-3p	Mirecords	external_info	{unchanged}	NA	17028171

Predicted Targets

	Summary Value
Count of predictions:	21657
Count of gene targets:	8827
Count of transcripts:	14389
Interacting mature miRNAs:	mmu-miR-7b-3p, mmu-miR-7b-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029827	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC026385	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608657	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083557

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	17	56,242,988 - 56,243,098 (+)	Ensembl

RefSeq Acc Id:

NR_029827

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	17	56,549,988 - 56,550,098 (+)	NCBI
GRCm38	17	56,242,988 - 56,243,098 (+)	ENTREZGENE
MGSCv37	17	56,382,411 - 56,382,521 (+)	RGD
cM Map	17		ENTREZGENE

Sequence:

show sequence

AGGAGCGGAGTACGTGAGCCAGTGCTATGTGGAAGACTTGTGATTTTGTTGTTCTGATATGATA
TGACAACAAGTCACAGCCAGCCTCATAGCGTGGACTCCTATCACCTT

hide sequence

Promoters

RGD ID:

13676496

Promoter ID:

EPDNEW_M22397

Type:

single initiation site

Name:

Mir7b_1

Description:

Mus musculus microRNA 7b , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	17	56,243,079 - 56,243,139	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619435	AgrOrtholog
Ensembl Genes	ENSMUSG00000065491	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083557	ENTREZGENE
MGD	MGI:3619435	ENTREZGENE
miRBase	MI0000730	ENTREZGENE
NCBI Gene	723883	ENTREZGENE
PhenoGen	Mir7b	PhenoGen
RNAcentral	URS0000224ED9	RNACentral
	URS000075AECB	RNACentral
	URS000075DE8D	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)