Mir100 (microRNA 100) - Rat Genome Database

Name: Mir100
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir100 (microRNA 100) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir100

Name:

microRNA 100

Description:

Involved in several processes, including cellular response to forskolin; cellular response to leukemia inhibitory factor; and long-term synaptic potentiation. Localizes to the synapse. Is expressed in embryo and lung.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-100; Mirn100; mmu-mir-100

Orthologs:

Homo sapiens (human) : MIR100 (microRNA 100) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir100 (microRNA 100) Alliance
Canis lupus familiaris (dog) : MIR99A-2 (microRNA mir-99a-2)
Sus scrofa (pig) : MIR100 (microRNA mir-100)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR100 (microRNA 100)	HGNC	HGNC
Rattus norvegicus (Norway rat):	Mir100 (microRNA 100)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR99A-2 (microRNA mir-99a-2)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MIR100 (microRNA mir-100)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	9	41,531,425 - 41,531,504 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	9	41,339,508 - 41,339,587 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	9	38,770,225 - 38,770,304 (+)	NCBI		Celera
Cytogenetic Map	9	A5.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
schizophrenia		ISO	RGD:1345382	8554872	ClinVar Annotator: match by term: Schizophrenia	ClinVar	PMID:21681106, PMID:30208311

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Alzheimer's disease		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:25992776
Animal Mammary Neoplasms		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:24447120
Chemical and Drug Induced Liver Injury		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106
Disease Progression		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:30026881
glomerulonephritis		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:25758243
hepatitis B		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106
Neoplasm Metastasis		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:19487542
pancreatitis		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27840954
transitional cell carcinoma		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:30026881
urinary bladder cancer		ISO	RGD:1345382	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:30026881

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
17beta-hydroxy-5alpha-androstan-3-one	decreases expression	ISO	RGD:1345382	6480464	Dihydrotestosterone results in decreased expression of MIR100 mRNA	CTD	PMID:25846647
2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	RGD:1345382	6480464	Tetrachlorodibenzodioxin results in increased expression of MIR100 mRNA	CTD	PMID:30096437
arsenous acid	increases expression	ISO	RGD:1345382	6480464	Arsenic Trioxide results in increased expression of MIR100 mRNA	CTD	PMID:22072212
bleomycin A2	decreases expression	ISO	RGD:2325389	6480464	Bleomycin results in decreased expression of MIR100 mRNA	CTD	PMID:25933445
diarsenic trioxide	increases expression	ISO	RGD:1345382	6480464	Arsenic Trioxide results in increased expression of MIR100 mRNA	CTD	PMID:22072212
formaldehyde	decreases expression	ISO	RGD:1345382	6480464	Formaldehyde results in decreased expression of MIR100 mRNA	CTD	PMID:21147603
hydrogen peroxide	increases expression	ISO	RGD:1345382	6480464	Hydrogen Peroxide results in increased expression of MIR100 mRNA	CTD	PMID:26339600
methapyrilene	affects expression	ISO	RGD:2325389	6480464	Methapyrilene affects the expression of MIR100 mRNA	CTD	PMID:24863736
microcystin-LR	decreases expression	ISO	RGD:1345382	6480464	cyanoginosin LR results in decreased expression of MIR100 mRNA	CTD	PMID:29518473
nitrofen	increases expression	ISO	RGD:2325389	6480464	nitrofen results in increased expression of MIR100 mRNA	CTD	PMID:26720608
paracetamol	increases expression	ISO	RGD:1345382	6480464	Acetaminophen results in increased expression of MIR100 mRNA	CTD	PMID:25092309, PMID:28545106
paracetamol	affects expression	ISO	RGD:2325389	6480464	Acetaminophen affects the expression of MIR100 mRNA	CTD	PMID:24863736
progesterone	decreases expression	ISO	RGD:1345382	6480464	Progesterone results in decreased expression of MIR100 mRNA	CTD	PMID:22950660
resveratrol	increases expression	ISO	RGD:1345382	6480464	Resveratrol results in increased expression of MIR100 mRNA	CTD	PMID:22016468
sodium arsenite	increases expression	ISO	RGD:1345382	6480464	sodium arsenite results in increased expression of MIR100 mRNA	CTD	PMID:29207610
streptozocin	decreases expression	EXP		6480464	Streptozocin results in decreased expression of MIR100 mRNA	CTD	PMID:27629361
zinc atom	decreases expression	ISO	RGD:2325389	6480464	Zinc deficiency results in decreased expression of MIR100 mRNA	CTD	PMID:22689922
zinc(0)	decreases expression	ISO	RGD:2325389	6480464	Zinc deficiency results in decreased expression of MIR100 mRNA	CTD	PMID:22689922

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular hyperosmotic salinity response		IDA		2290270	(MGI:MGI:3691268, PMID:17028171)	MGI	MGI:MGI:3691268, PMID:17028171
cellular response to forskolin		IEP		2290270	(MGI:MGI:5305371, PMID:21993888)	MGI	MGI:MGI:5305371, PMID:21993888
cellular response to inorganic substance		IDA		2290270	(MGI:MGI:5305371, PMID:21993888)	MGI	MGI:MGI:5305371, PMID:21993888
cellular response to leukemia inhibitory factor		IEP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
gene silencing by miRNA		IDA		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
long-term synaptic potentiation		IEP		2290270	(MGI:MGI:5645435, PMID:25858512)	MGI	MGI:MGI:5645435, PMID:25858512
myelination		IDA		2290270	(MGI:MGI:4830414, PMID:20805985)	MGI	MGI:MGI:4830414, PMID:20805985
positive regulation of stem cell differentiation		IMP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
sensory perception of sound		IEP		2290270	(MGI:MGI:5508842, PMID:23646144)	MGI	MGI:MGI:5508842, PMID:23646144

Cellular Component

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
synapse		IDA		2290270	(MGI:MGI:5449129, PMID:22897173)	MGI	MGI:MGI:5449129, PMID:22897173

Disease Annotations

	Alzheimer's disease (ISO)
	Animal Mammary Neoplasms (ISO)
	Chemical and Drug Induced Liver Injury (ISO)
	Disease Progression (ISO)

	glomerulonephritis (ISO)
	hepatitis B (ISO)
	Neoplasm Metastasis (ISO)
	pancreatitis (ISO)

	schizophrenia (ISO)
	transitional cell carcinoma (ISO)
	urinary bladder cancer (ISO)

Gene-Chemical Interaction Annotations

	17beta-hydroxy-5alpha-androstan-3-one (ISO)
	2,3,7,8-tetrachlorodibenzodioxine (ISO)
	arsenous acid (ISO)
	bleomycin A2 (ISO)
	diarsenic trioxide (ISO)
	formaldehyde (ISO)

	hydrogen peroxide (ISO)
	methapyrilene (ISO)
	microcystin-LR (ISO)
	nitrofen (ISO)
	paracetamol (ISO)
	progesterone (ISO)

	resveratrol (ISO)
	sodium arsenite (ISO)
	streptozocin (EXP)
	zinc atom (ISO)
	zinc(0) (ISO)

Gene Ontology Annotations

Biological Process

	cellular hyperosmotic salinity response (IDA)
	cellular response to forskolin (IEP)
	cellular response to inorganic substance (IDA)
	cellular response to leukemia inhibitory factor (IEP)
	gene silencing by miRNA (IDA)

	long-term synaptic potentiation (IEP)
	myelination (IDA)
	positive regulation of stem cell differentiation (IMP)
	sensory perception of sound (IEP)

Cellular Component

synapse (IDA)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

11914277 15634332 16369549 16381832 17028171 17369397 17604727 18452032 19559694 20215419 20413612 20439489 20668074 20805985 21037258 21267068 21339483 21822254 21993888 22144232 22629237 22897173 23646144 23724047 24944008 25359213 25858512 26191255 29208678

Genomics

Comparative Map Data

Mir100
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	9	41,531,425 - 41,531,504 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	9	41,339,508 - 41,339,587 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	9	38,770,225 - 38,770,304 (+)	NCBI		Celera
Cytogenetic Map	9	A5.1	NCBI

MIR100
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	11	122,152,229 - 122,152,308 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	11	122,022,937 - 122,023,016 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	11	121,528,146 - 121,528,225 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	11	119,183,604 - 119,183,683 (-)	NCBI
Cytogenetic Map	11	q24.1	NCBI
HuRef	11	117,969,463 - 117,969,542 (-)	NCBI		HuRef
CHM1_1	11	121,910,234 - 121,910,313 (-)	NCBI		CHM1_1

Mir100
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	8	45,746,948 - 45,747,027 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	8	45,746,948 - 45,747,027 (+)	Ensembl
Rnor_5.0	8	44,222,150 - 44,222,229 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	8	41,500,067 - 41,500,146 (+)	NCBI		Celera
Cytogenetic Map	8	q22	NCBI

MIR99A-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	12,047,369 - 12,047,425 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	5		NCBI

MIR100
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1	9	49,157,909 - 49,157,988 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	9	54,383,382 - 54,383,461 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3
Pig Cytomap	9		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
13504833	Bglu19_m	blood glucose level 19 (mouse)					9	9999472	43999472	Mouse
1300532	Tbs2_m	tuberculosis severity 2 (mouse)			Not determined		9	12458674	46458818	Mouse
10043917	Obq37_m	obesity QTL 37 (mouse)			Not determined		9	13479879	47479879	Mouse
1357637	Si5lq2_m	serum IGFBP-5 level QTL 2 (mouse)			Not determined		9	15500455	49500594	Mouse
4141447	Cfmq2_m	cystic fibrosis modifier QTL 2 (mouse)			Not determined		9	15500455	49500594	Mouse
4141591	Cq4_m	cholesterol QTL 4 (mouse)			Not determined		9	15500455	49500594	Mouse
1301421	Lgth4_m	body length 4 (mouse)			Not determined		9	15500455	49500594	Mouse
11354951	Pdcc3_m	plasmacytoid dentritic cell compartment 3 (mouse)					9	15838331	49838331	Mouse
12790993	Adq1_m	aortic diameter QTL 1 (mouse)					9	15838331	49838331	Mouse
12790997	Adq2_m	aortic diameter QTL 2 (mouse)					9	15838331	49838331	Mouse
12880415	V125Dq7_m	vitamin D active form serum level QTL 7 (mouse)					9	16100000	50100000	Mouse
12880416	V125Dq8_m	vitamin D active form serum level QTL 8 (mouse)					9	16100000	50100000	Mouse
13504834	Hdlq109_m	HDL QTL 109 (mouse)					9	16798345	50798345	Mouse
1357465	Vtbt6_m	vertebral trabecular bone trait 6 (mouse)			Not determined		9	17067544	51067647	Mouse
1300643	Pvcan2_m	protection against vaginal candidiasis 2 (mouse)			Not determined		9	20032110	54032229	Mouse
1301439	Morph2_m	morphine antinociception 2 (mouse)			Not determined		9	20242066	54242196	Mouse
1301045	Sluc10_m	susceptibility to lung cancer 10 (mouse)			Not determined		9	20394901	54395074	Mouse
1301883	Skull12_m	skull morphology 12 (mouse)			Not determined		9	20394901	54395074	Mouse
4142352	Lmr17_m	leishmaniasis resistance 17 (mouse)			Not determined		9	20394901	54395074	Mouse
10043950	Pbft5_m	percent body fat 5 (mouse)			Not determined		9	20394901	54395074	Mouse
12904939	Edlmmq8_m	extensor digitorum longus muscle mass QTL 8 (mouse)					9	20941444	54941444	Mouse
13208563	Bmiq8_m	body mass index QTL 8 (mouse)					9	25000000	69000000	Mouse
11532694	Sluc39a_m	susceptibility to lung cancer 39a (mouse)					9	25676189	59676285	Mouse
11532695	Sluc39b_m	susceptibility to lung cancer 39b (mouse)					9	25676189	59676285	Mouse
11532696	Sluc39c_m	susceptibility to lung cancer 39c (mouse)					9	25676189	59676285	Mouse
11532712	Sluc39d_m	susceptibility to lung cancer 39d (mouse)					9	25676189	59676285	Mouse
1300932	Hdlq17_m	HDL QTL 17 (mouse)			Not determined		9	26885124	60885255	Mouse
10043867	Mtbcq9_m	multiple trait body composition QTL 9 (mouse)			Not determined		9	26885124	60885255	Mouse
10043987	Stheal13_m	soft tissue heal 13 (mouse)			Not determined		9	26885124	60885255	Mouse
10043878	Adip20_m	adiposity 20 (mouse)			Not determined		9	27339897	61340026	Mouse
1301000	Obq5_m	obesity QTL 5 (mouse)			Not determined		9	28592037	41888030	Mouse
10043847	Hdlq89_m	HDL QTL 89 (mouse)			Not determined		9	29381631	63381774	Mouse
1301782	Chol11_m	cholesterol 11 (mouse)			Not determined		9	29381631	63381774	Mouse
1301365	Ap5q_m	alcohol preference 5 QTL (mouse)			Not determined		9	30141866	64141979	Mouse
1357746	Vtbt7_m	vertebral trabecular bone trait 7 (mouse)			Not determined		9	30828617	64828723	Mouse
1302180	Actd4_m	activity-distance traveled 4 (mouse)			Not determined		9	32523263	66523557	Mouse
4141148	Cq5_m	cholesterol QTL 5 (mouse)			Not determined		9	32541121	66541246	Mouse
1301692	Hts_m	hypothermia sensitivity (mouse)			Not determined		9	32599872	66600121	Mouse
4141323	Ptnu3_m	proteinuria 3 (mouse)			Not determined		9	32978402	66978536	Mouse
1357709	Si5lq3_m	serum IGFBP-5 level QTL 3 (mouse)			Not determined		9	33199725	67199840	Mouse
1558872	Ibdq1_m	inflammatory bowel disease QTL 1 (mouse)			Not determined		9	34067544	73531973	Mouse
1357682	Phdlc1_m	plasma HDL cholesterol 1 (mouse)			Not determined		9	34193323	42853570	Mouse
1301252	Etohc3_m	ethanol consumption 3 (mouse)			Not determined		9	35123178	69123299	Mouse
1301972	Cocrb8_m	cocaine related behavior 8 (mouse)			Not determined		9	35123178	69123299	Mouse
1558968	Tbdr1_m	body temperature response to dietary restriction, QTL 1 (mouse)			Not determined		9	35123178	69123299	Mouse
10045613	Rapop7_m	radiation-induced apoptosis 6 (mouse)			Not determined		9	36824947	49509211	Mouse
1301501	Lmr2_m	leishmaniasis resistance 2 (mouse)			Not determined		9	37032110	50199840	Mouse
1301007	Pid2_m	prion incubation determinant 2 (mouse)			Not determined		9	37242066	44340026	Mouse
4142042	Alpq3_m	alcohol preference QTL 3 (mouse)			Not determined		9	37394901	98819654	Mouse
10043971	Obq32_m	obesity QTL 32 (mouse)			Not determined		9	37912244	71912244	Mouse
12791002	Arlsq2_m	aortic root lesion size QTL 2 (mouse)					9	38192291	72192291	Mouse
12790986	Pcho9_m	plasma cholesterol 9 (mouse)					9	38192291	72192291	Mouse
12790992	Arlsq1_m	aortic root lesion size QTL 1 (mouse)					9	38192291	72192291	Mouse
12738449	Spcq2_m	sperm count QTL 2 (mouse)					9	39492601	73492601	Mouse
1558993	Tdmq1_m	type 2 diabetes modifying QTL 1 (mouse)			Not determined		9	40508298	51897370	Mouse
4141071	Ath29_m	atherosclerosis 29 (mouse)			Not determined		9	40508298	74700643	Mouse
11532693	Sluc39_m	susceptibility to lung cancer 39 (mouse)					9	40734078	48440176	Mouse
1301702	Brm1_m	brachyury modifier 1 (mouse)			Not determined		9	40897764	74897921	Mouse
12738415	Lfibq8_m	liver fibrosis QTL 8 (mouse)					9	41490866	45432445	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Smarca5	mmu-miR-100-5p	Mirecords	external_info	NA	NA	20439489
Mtor	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	23292834
Plk1	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	23151088
Plk1	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	22249248
Plk1	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	22246341
Plk1	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	22120675
Smarca5	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	21212412
Atm	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	20869334
Igf1r	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	20484036
Plk1	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	19739117
Ctdspl	mmu-miR-100-5p	OncomiRDB	external_info	NA	NA	21643017

Predicted Targets

	Summary Value
Count of predictions:	10507
Count of gene targets:	5619
Count of transcripts:	8759
Interacting mature miRNAs:	mmu-miR-100-3p, mmu-miR-100-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029790	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	CT009696	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608620	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029790

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	9	41,531,425 - 41,531,504 (+)	ENTREZGENE
MGSCv37	9	41,339,508 - 41,339,587 (+)	RGD
Celera	9	38,770,225 - 38,770,304 (+)	RGD
cM Map	9		ENTREZGENE

Sequence:

show sequence

CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGCTGATTCTGCACACAAGCTTGTGTCTATAG
GTATGTGTCTGTTAGG

hide sequence

Promoters

RGD ID:

8669310

Promoter ID:

EPDNEW_M12686

Type:

single initiation site

Name:

Mir100_1

Description:

Mus musculus microRNA 100 , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	9	41,531,497 - 41,531,557	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000093011	ENTREZGENE
Ensembl Transcript	ENSMUST00000175270	ENTREZGENE
MGD	MGI:3619057	ENTREZGENE
miRBase	MI0000692	ENTREZGENE
NCBI Gene	723892	ENTREZGENE
PhenoGen	Mir100	PhenoGen
RNAcentral	URS0000000F88	RNACentral
	URS000040D674	RNACentral
	URS000075B831	RNACentral

More on Mir100
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1608164
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-11-27
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.