Mir26a-1 (microRNA 26a-1) - Rat Genome Database

Name: Mir26a-1
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir26a-1 (microRNA 26a-1) Mus musculus

Analyze

Symbol:

Mir26a-1

Name:

microRNA 26a-1

RGD ID:

1607668

MGI Page

MGI

Description:

Involved in several processes, including cellular response to mechanical stimulus; long-term synaptic potentiation; and negative regulation of macromolecule metabolic process. Localizes to RISC complex and extracellular exosome. Is expressed in several structures, including brain and lung. Orthologous to human MIR26A1 (microRNA 26a-1).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

Mir; miR-26a; mir-26a-1; Mirn2; Mirn26a; Mirn26a-1

RGD Orthologs

Human

Rat

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	118,860,864 - 118,860,953 (+)	NCBI	GRCm39		mm39
GRCm38	9	119,031,796 - 119,031,885 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	119,031,796 - 119,031,885 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	118,940,914 - 118,941,003 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	9	119,499,693 - 119,499,782 (+)	NCBI		Celera
Cytogenetic Map	9	F3	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

acute kidney failure (ISO)

adult respiratory distress syndrome (ISO)

Brugada syndrome (ISO)

Experimental Arthritis (ISO)

Experimental Liver Neoplasms (ISO)

Myocardial Reperfusion Injury (ISO)

Visceral Heterotaxy 4, Autosomal (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

aflatoxin B1 (ISO)

arecoline (ISO)

bis(2-ethylhexyl) phthalate (ISO)

bleomycin A2 (ISO)

cisplatin (ISO)

formaldehyde (ISO)

methotrexate (ISO)

morphine (ISO)

notoginsenoside R1 (ISO)

perfluorooctane-1-sulfonic acid (ISO)

poly(I:C) (ISO)

pristane (ISO)

quartz (ISO)

resveratrol (ISO)

sodium arsenite (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to lipopolysaccharide (IDA)

cellular response to mechanical stimulus (IDA)

embryo implantation (IDA)

gene silencing by miRNA (IDA)

long-term synaptic potentiation (IEP)

negative regulation of G1/S transition of mitotic cell cycle (IDA)

negative regulation of protein phosphorylation (IDA)

response to bacterium (IEP)

response to wounding (IEP)

Cellular Component

extracellular exosome (IDA)

RISC complex (IDA)

Phenotype Annotations Click to see Annotation Detail View

Mammalian Phenotype

abnormal pancreatic alpha cell morphology (IAGP)

decreased pancreatic islet number (IAGP)

enlarged pancreatic islets (IAGP)

increased circulating glucose level (IAGP)

increased circulating insulin level (IAGP)

increased fasting circulating glucose level (IAGP)

increased pancreatic beta cell proliferation (IAGP)

increased susceptibility to diet-induced obesity (IAGP)

insulin resistance (IAGP)

pancreatic islet hyperplasia (IAGP)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:12007417	PMID:15538371	PMID:15845075	PMID:16369549	PMID:16381832	PMID:16766679	PMID:17369397	PMID:17604727	PMID:18281287	PMID:18452032	PMID:18556655	PMID:18713946
PMID:18762567	PMID:19524505	PMID:19559694	PMID:19701194	PMID:20215419	PMID:20413612	PMID:20739651	PMID:20857419	PMID:21037258	PMID:21267068	PMID:21718763	PMID:21822254
PMID:21903578	PMID:22210897	PMID:22496754	PMID:22673513	PMID:23028144	PMID:23254997	PMID:23543060	PMID:24047927	PMID:24114270	PMID:24205035	PMID:24328779	PMID:24594795
PMID:25329154	PMID:25362566	PMID:25395662	PMID:25518928	PMID:25728641	PMID:25766405	PMID:25801675	PMID:25808510	PMID:25858512	PMID:25865461	PMID:25907560	PMID:25959411
PMID:25961460	PMID:26050992	PMID:26063197	PMID:26107166	PMID:26247736	PMID:26313916	PMID:26320674	PMID:26376347	PMID:26776318	PMID:26787543	PMID:26818545	PMID:27040676
PMID:27377869	PMID:28174206	PMID:28558034	PMID:28622289	PMID:29191656	PMID:29436664	PMID:29515367	PMID:29952219	PMID:30024304	PMID:30703362	PMID:30718039	PMID:31210329
PMID:31338931	PMID:31364731	PMID:31474996	PMID:31488578	PMID:31593640	PMID:31964775	PMID:32092075

Genomics

Comparative Map Data

Mir26a-1
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	118,860,864 - 118,860,953 (+)	NCBI	GRCm39		mm39
GRCm38	9	119,031,796 - 119,031,885 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	119,031,796 - 119,031,885 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	118,940,914 - 118,941,003 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	9	119,499,693 - 119,499,782 (+)	NCBI		Celera
Cytogenetic Map	9	F3	NCBI

MIR26A1
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	3	37,969,404 - 37,969,480 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	3	37,969,404 - 37,969,480 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	3	38,010,895 - 38,010,971 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	3	37,985,898 - 37,985,974 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	3	37,945,267 - 37,945,343 (+)	NCBI
Cytogenetic Map	3	p22.2	NCBI
HuRef	3	37,953,581 - 37,953,657 (+)	NCBI		HuRef
CHM1_1	3	37,962,544 - 37,962,620 (+)	NCBI		CHM1_1

Mir26a
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	8	127,714,441 - 127,714,530 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	8	127,714,441 - 127,714,530 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	8	126,931,592 - 126,931,681 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	8	117,928,870 - 117,928,959 (+)	NCBI		Celera
Cytogenetic Map	8	q32	NCBI

MIR26A-1
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	23	7,747,064 - 7,747,140 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	23	7,747,073 - 7,747,133 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4141833	W10q13_m	weight 10 weeks QTL 13 (mouse)			Not determined			63332429	120362868	Mouse
4141545	Tailaq2_m	tail length adjusted QTL 2 (mouse)			Not determined			63332429	120362868	Mouse
1357635	Splq4_m	spleen weight QTL 4 (mouse)			Not determined		9	63332429	120362868	Mouse
1300549	Bbaa17_m	B. burgdorferi-associated arthritis 17 (mouse)			Not determined		9	86230401	120230530	Mouse
1302103	Dob2_m	dietary obesity 2 (mouse)			Not determined		9	86239845	120289624	Mouse
11251716	Siim2_m	stress induced immobility 2 (mouse)					9	86748483	120748483	Mouse
12880422	V25Dq6_m	vitamin D inactive form serum level QTL 6 (mouse)					9	87800000	121800000	Mouse
10412242	Alpq8_m	alcohol preference QTL 8 (mouse)			Not determined		9	89284925	123284925	Mouse
1301649	Psl1_m	promotion susceptibility QTL 1 (mouse)			Not determined		9	89412277	123412396	Mouse
18182932	Metl3_m	metabolite locus 3, N-acetylglutamate (mouse)					9	89563342	123563342	Mouse
12910770	Splic1_m	spleen iron content 1 (mouse)					9	91413879	124595110	Mouse
12910772	Lvic6_m	liver iron content 6 (mouse)					9	91413879	124595110	Mouse
12910773	Splic3_m	spleen iron content 3 (mouse)					9	91413879	124595110	Mouse
1558767	Skmw11_m	skeletal muscle weight 11 (mouse)			Not determined		9	91641084	124595110	Mouse
13463474	Hbbcq5_m	hemoglobin concentration QTL 5 (mouse)					9	91641084	124595110	Mouse
13463475	Hctq7_m	hematocrit QTL 7 (mouse)					9	91641084	124595110	Mouse
13463477	Rbc9_m	red blood cell count 9 (mouse)					9	91641084	124595110	Mouse
13463478	Mchq18_m	mean corpuscular hemoglobin QTL 18 (mouse)					9	91641084	124595110	Mouse
13463480	Mchcq2_m	mean corpuscular hemoglobin concentration QTL 2 (mouse)					9	91641084	124595110	Mouse
12904937	Edlmmq9_m	extensor digitorum longus muscle mass QTL 9 (mouse)					9	91683173	124595110	Mouse
12904947	Tammq7_m	tibialis anterior muscle mass QTL 7 (mouse)					9	91683173	124595110	Mouse
12904961	Gmmq7_m	gastrocnemius muscle mass QTL 7 (mouse)					9	91683173	124595110	Mouse
1302001	Bdln5_m	body length 5 (mouse)			Not determined		9	93762590	124595110	Mouse
1301484	Bwq6_m	body weight (mouse)			Not determined		9	93762590	124595110	Mouse
14746992	Manh67_m	mandible shape 67 (mouse)					9	94036768	124595110	Mouse
11537364	Cnes5_m	C. neoformans susceptibility locus 5 (mouse)					9	96917590	124595110	Mouse
1301297	Lcho1_m	liver cholesterol 1 (mouse)			Not determined		9	101060861	124595110	Mouse
1357627	Tgq2_m	triglyceride QTL 2 (mouse)			Not determined		9	102000187	124595110	Mouse
1357648	Obq18_m	obesity QTL 18 (mouse)			Not determined		9	102000187	124595110	Mouse
1301789	Pbwg4_m	postnatal body weight growth 4 (mouse)			Not determined		9	103289445	124595110	Mouse
10412290	Pvacm1l_m	plasma vascular cell adhesion molecule 1 levels (mouse)			Not determined		9	103289445	124595110	Mouse
12879896	Berr3_m	berghei resistance locus 3 (mouse)					9	103289445	124595110	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Ezh2	mmu-miR-26a-5p	Mirtarbase	external_info	qRT-PCR//Western blot//Reporter assay;Western blot	Functional MTI	18281287
Srcin1	mmu-miR-26a-5p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Ezh2	mmu-miR-26a-5p	Tarbase	external_info	Reporter Gene	POSITIVE
Ezh2	mmu-miR-26a-5p	Tarbase	external_info	qPCR	POSITIVE
Ezh2	mmu-miR-26a-5p	Tarbase	external_info	Westernblit	POSITIVE
Spred3	mmu-miR-26a-5p	Tarbase	external_info	Sequencing	POSITIVE
Il6	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	23389848
Nanos2	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	23338972
Bag4	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	23190898
Pten	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	22885155
Gsk3b	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	22484120
Cdk6	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	22210897
Esr1	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	21610700
Ezh2	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	21368858
Ezh2	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	21199804
Mtdh	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	20952513
Pten	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	20080666
Ccnd2	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	19524505
Pten	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	19487573
Ezh2	mmu-miR-26a-5p	OncomiRDB	external_info	NA	NA	18713946

Predicted Targets

	Summary Value
Count of predictions:	8908
Count of gene targets:	4577
Count of transcripts:	6871
Interacting mature miRNAs:	mmu-miR-26a-1-3p
Prediction methods:	Microtar, Miranda, Pita, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029742	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC055818	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ459716	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608571	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083579

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	9	119,031,796 - 119,031,885 (+)	Ensembl

RefSeq Acc Id:

NR_029742

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	9	118,860,864 - 118,860,953 (+)	NCBI
GRCm38	9	119,031,796 - 119,031,885 (+)	ENTREZGENE
MGSCv37	9	118,940,914 - 118,941,003 (+)	RGD
Celera	9	119,499,693 - 119,499,782 (+)	RGD
cM Map	9		ENTREZGENE

Sequence:

show sequence

AAGGCCGTGGCCTCGTTCAAGTAATCCAGGATAGGCTGTGCAGGTCCCAAGGGGCCTATTCTTG
GTTACTTGCACGGGGACGCGGGCCTG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676900	AgrOrtholog
Ensembl Genes	ENSMUSG00000065513	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083579	ENTREZGENE
MGD	MGI:2676900	ENTREZGENE
miRBase	MI0000573	ENTREZGENE
NCBI Gene	387218	ENTREZGENE
PhenoGen	Mir26a-1	PhenoGen
RNAcentral	URS00000C0D3F	RNACentral
	URS000019B0F7	RNACentral
	URS000075D9C9	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD