Mir27a (microRNA 27a) - Rat Genome Database

Name: Mir27a
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: Mir27a (microRNA 27a) Mus musculus

Analyze

Symbol:

Mir27a

Name:

microRNA 27a

RGD ID:

1607666

MGI Page

MGI

Description:

Acts upstream of or within several processes, including cellular response to leukemia inhibitory factor; cellular response to phenylalanine; and retina vasculature development in camera-type eye. Part of RISC complex and RISC-loading complex. Is expressed in bone; embryo; heart; limb; and long bone. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR27A (microRNA 27a).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

Mir; mir-27a; Mirn27a; mmu-mir-; mmu-mir-27a

RGD Orthologs

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	84,935,301 - 84,935,387 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	8	84,935,301 - 84,935,387 (+)	Ensembl		GRCm39 Ensembl
GRCm38	8	84,208,672 - 84,208,758 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	84,208,672 - 84,208,758 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	8	86,732,571 - 86,732,657 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	8	88,508,778 - 88,508,864 (+)	NCBI		Celera
Cytogenetic Map	8	C2	NCBI
cM Map	8	40.58	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

colorectal cancer (ISO)

congestive heart failure (ISO)

hepatocellular carcinoma (ISO)

intrahepatic cholestasis (IEP)

multiple myeloma (ISO)

Myocardial Reperfusion Injury (ISO)

pancreatitis (ISO)

type 2 diabetes mellitus (ISO)

urinary bladder cancer (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (EXP,ISO)

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2,5-hexanedione (ISO)

2-hydroxypropanoic acid (ISO)

3-chloropropane-1,2-diol (EXP)

aflatoxin B1 (ISO)

alpha-hexylcinnamaldehyde (ISO)

arsane (EXP,ISO)

arsenic atom (EXP,ISO)

arsenite(3-) (EXP,ISO)

arsenous acid (ISO)

benzo[a]pyrene (ISO)

bleomycin A2 (ISO)

cadmium atom (EXP,ISO)

cadmium dichloride (EXP,ISO)

carbon nanotube (EXP,ISO)

cisplatin (EXP,ISO)

crocidolite asbestos (ISO)

curcumin (ISO)

cyclosporin A (ISO)

DDT (ISO)

diarsenic trioxide (ISO)

doxorubicin (ISO)

ethanol (ISO)

formaldehyde (ISO)

ionomycin (ISO)

Licochalcone B (ISO)

mechlorethamine (ISO)

methamidophos (ISO)

methapyrilene (ISO)

microcystin-LR (ISO)

nickel atom (ISO)

nickel sulfate (ISO)

nitrofen (ISO)

paracetamol (ISO)

paraquat (ISO)

progesterone (ISO)

quercetin (ISO)

quercetin 3-O-beta-D-galactopyranoside (ISO)

rac-lactic acid (ISO)

resveratrol (ISO)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (ISO)

sodium fluoride (ISO)

streptozocin (EXP,ISO)

tamoxifen (ISO)

titanium dioxide (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to glucose stimulus (IDA)

cellular response to leukemia inhibitory factor (IEP)

cellular response to lipopolysaccharide (IDA)

cellular response to phenylalanine (IEP)

cellular response to transforming growth factor beta stimulus (ISO)

cellular response to tumor necrosis factor (ISO)

cellular response to vascular endothelial growth factor stimulus (ISO)

lactation (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of gene expression (ISO)

negative regulation of interleukin-1-mediated signaling pathway (ISO)

negative regulation of low-density lipoprotein particle clearance (ISO)

negative regulation of SMAD protein signal transduction (ISO)

negative regulation of T cell activation (ISO)

ossification (IDA)

positive regulation of angiogenesis (IMP)

positive regulation of apoptotic process (ISO)

positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis (ISO)

positive regulation of cell migration involved in sprouting angiogenesis (ISO)

positive regulation of ERK1 and ERK2 cascade (ISO)

positive regulation of Fas signaling pathway (ISO)

positive regulation of gene expression (ISO)

positive regulation of vascular endothelial cell proliferation (ISO)

regulation of gene expression (IMP)

regulation of semaphorin-plexin signaling pathway (IMP)

response to muscle activity (ISO)

retina vasculature development in camera-type eye (IMP)

Cellular Component

extracellular exosome (ISO)

RISC complex (IDA)

RISC-loading complex (IDA)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	MicroRNA-27a-3p inhibits cell viability and migration through down-regulating DUSP16 in hepatocellular carcinoma.	Li JM, etal., J Cell Biochem. 2018 Jul;119(7):5143-5152. doi: 10.1002/jcb.26526. Epub 2018 Apr 17.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
3.	Myocardial infarction-induced microRNA-enriched exosomes contribute to cardiac Nrf2 dysregulation in chronic heart failure.	Tian C, etal., Am J Physiol Heart Circ Physiol. 2018 May 1;314(5):H928-H939. doi: 10.1152/ajpheart.00602.2017. Epub 2018 Jan 26.
4.	Activation of a novel c-Myc-miR27-prohibitin 1 circuitry in cholestatic liver injury inhibits glutathione synthesis in mice.	Yang H, etal., Antioxid Redox Signal. 2015 Jan 20;22(3):259-74. doi: 10.1089/ars.2014.6027. Epub 2014 Oct 17.
5.	Self-assembled dual fluorescence nanoparticles for CD44-targeted delivery of anti-miR-27a in liver cancer theranostics.	Zheng X, etal., Theranostics. 2018 Jun 13;8(14):3808-3823. doi: 10.7150/thno.25255. eCollection 2018.

Additional References at PubMed

PMID:12007417	PMID:12554860	PMID:12919684	PMID:15538371	PMID:16369549	PMID:16381832	PMID:17369397	PMID:17604727	PMID:18762567	PMID:19878148	PMID:20060380	PMID:20215419
PMID:20413612	PMID:20417623	PMID:20439489	PMID:20980664	PMID:21037258	PMID:21149577	PMID:21267068	PMID:21536891	PMID:21749861	PMID:22184245	PMID:22346748	PMID:22415194
PMID:22503104	PMID:22564414	PMID:22640741	PMID:23034448	PMID:23322776	PMID:23637774	PMID:24049083	PMID:24123794	PMID:24218084	PMID:24244514	PMID:24457907	PMID:24487055
PMID:24498167	PMID:24651435	PMID:24835395	PMID:25043848	PMID:25050919	PMID:25057207	PMID:25166914	PMID:25519956	PMID:25751060	PMID:26006230	PMID:26107383	PMID:26540574
PMID:26709778	PMID:26822703	PMID:26834155	PMID:26850657	PMID:27142530	PMID:27471470	PMID:27554624	PMID:27612006	PMID:27636893	PMID:28365247	PMID:28400445	PMID:29089199
PMID:29101357	PMID:29476741	PMID:29721071	PMID:30145824	PMID:30231673	PMID:30242124	PMID:30272823	PMID:30327467	PMID:30535438	PMID:30664207	PMID:31298345	PMID:31518965
PMID:31526292	PMID:32071155	PMID:32084559	PMID:32317602	PMID:32502201	PMID:32546573	PMID:32593682	PMID:32691413	PMID:32705283	PMID:32896839	PMID:33215816	PMID:33515696
PMID:33843447	PMID:33875617	PMID:33902432	PMID:33910455	PMID:34107258	PMID:34676493	PMID:34749531	PMID:35348441	PMID:36288764	PMID:36752600	PMID:36925075	PMID:37216657
PMID:37542720	PMID:37777412

Genomics

Comparative Map Data

Mir27a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	84,935,301 - 84,935,387 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	8	84,935,301 - 84,935,387 (+)	Ensembl		GRCm39 Ensembl
GRCm38	8	84,208,672 - 84,208,758 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	84,208,672 - 84,208,758 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	8	86,732,571 - 86,732,657 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	8	88,508,778 - 88,508,864 (+)	NCBI		Celera
Cytogenetic Map	8	C2	NCBI
cM Map	8	40.58	NCBI

MIR27A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	13,836,440 - 13,836,517 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	19	13,836,440 - 13,836,517 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	19	13,947,254 - 13,947,331 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	13,808,253 - 13,808,330 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	19	13,841,002 - 13,841,079 (-)	NCBI		Celera
Cytogenetic Map	19	p13.12	NCBI
HuRef	19	13,518,822 - 13,518,899 (-)	NCBI		HuRef
CHM1_1	19	13,947,759 - 13,947,836 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	19	13,962,572 - 13,962,649 (-)	NCBI		T2T-CHM13v2.0

Mir27a
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	19	40,859,603 - 40,859,689 (-)	NCBI		GRCr8
mRatBN7.2	19	23,954,831 - 23,954,917 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	19	23,954,831 - 23,954,917 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	19	30,775,691 - 30,775,777 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	19	31,430,100 - 31,430,186 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	19	33,652,869 - 33,652,955 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	19	25,318,736 - 25,318,822 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	19	25,318,736 - 25,318,822 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	19	36,294,924 - 36,295,010 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	19	23,503,679 - 23,503,765 (-)	NCBI		Celera
Cytogenetic Map	19	q11	NCBI

MIR27A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	20	48,620,556 - 48,620,615 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	20	48,620,556 - 48,620,615 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	20	48,494,476 - 48,494,535 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	20	49,138,667 - 49,138,726 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	20	49,138,667 - 49,138,726 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	20	48,349,144 - 48,349,203 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	20	48,776,060 - 48,776,119 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	20	49,019,128 - 49,019,187 (+)	NCBI		UU_Cfam_GSD_1.0

MIR27A
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	2	65,308,294 - 65,308,375 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	2	65,308,294 - 65,308,375 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	2	65,582,015 - 65,582,096 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Variants

Variants in Mir27a
1 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	29856
Count of gene targets:	12806
Count of transcripts:	22294
Interacting mature miRNAs:	mmu-miR-27a-3p, mmu-miR-27a-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357787	Vtbt5_m	vertebral trabecular bone trait 5 (mouse)			Not determined		8	66084397	100084549	Mouse
1301872	Cd4ts3_m	CD4 T cell subset 3 (mouse)			Not determined		8	72122809	106123021	Mouse
12904012	Cfq10_m	conditioned fear QTL 10 (mouse)					8	80793404	89740987	Mouse
1301581	Char2_m	P. chabaudi malaria resistance QTL 2 (mouse)			Not determined		8	79808806	113809031	Mouse
1301952	Im3_m	immunoregulatory 3 (mouse)			Not determined		8	55159258	89159407	Mouse
4140967	Bmd39_m	bone mineral density 39 (mouse)			Not determined		8	32506572	117965439	Mouse
4141285	Tgq18_m	triglyceride QTL 18 (mouse)			Not determined			64186736	98186736	Mouse
4141797	Skmw16_m	skeletal muscle weight 16 (mouse)			Not determined		8	64666176	98666325	Mouse
27095912	Pglq14_m	pelvic girdle length QTL 14, 16 week (mouse)					8	74126628	126826739	Mouse
1558875	Eae31_m	experimental allergic encephalomyelitis susceptibility 31 (mouse)			Not determined		8	35109930	115563747	Mouse
14700686	Civq3_m	cerebral infarct volume QTL 3 (mouse)					8	52334843	86334843	Mouse
10043975	Obq31_m	obesity QTL 31 (mouse)			Not determined		8	59136404	93136404	Mouse
10043992	Hbnr11_m	Heligmosomoides bakeri nematode resistance 11 (mouse)			Not determined		8	66326836	100326976	Mouse
1558890	Lith18_m	lithogenic gene 18 (mouse)			Not determined		8	76402145	110402251	Mouse
1357470	Obq16_m	obesity QTL 16 (mouse)			Not determined		8	76411976	110412125	Mouse
10755530	Wbc2_m	white blood cell count 2 (mouse)					8	81819296	115819296	Mouse
12904744	Carcdq1_m	cardiac collagen deposition QTL 1 (mouse)					8	40162297	95416226	Mouse
10412287	Carg3_m	Candida albicans resistance gene 3 (mouse)			Not determined		8	56298872	90298872	Mouse
1301767	Fcsa2_m	femoral cross-sectional area 2 (mouse)			Not determined		8	71032003	105032123	Mouse
1301506	Aevm1_m	autoimmune extremity vasculitis in MRL mice 1 (mouse)			Not determined		8	54740461	88740637	Mouse
10412234	Nhdlq14_m	non-HDL QTL 14 (mouse)			Not determined		8	76411976	110412125	Mouse
11353828	Gf7_m	gonadal fat pad weight 7 (mouse)					8	58928107	92928107	Mouse
1301688	Orch6_m	autoimmune orchitis resistance 6 (mouse)			Not determined		8	61513479	95513605	Mouse
4141395	Char2a_m	P. chabaudi malaria resistance QTL 2a (mouse)			Not determined			71589427	90929226	Mouse
10755519	Wbc1_m	white blood cell count 1 (mouse)					8	82345783	116345783	Mouse
27226754	Femd6_m	femur midshaft diameter 6, 10 week (mouse)					8	37867154	110326632	Mouse
4142283	Imraq2_m	immune response to AAV2 QTL 2 (mouse)			Not determined		8	71032003	105032123	Mouse
1300920	Pitm3_m	prion incubation time 3 (mouse)			Not determined		8	73929123	107929226	Mouse
1301874	Hdlq16_m	HDL QTL 16 (mouse)			Not determined		8	76411976	110412125	Mouse
1301099	Cbm2_m	cerebellum weight 2 (mouse)			Not determined		8	79245241	113245331	Mouse
1301013	Capsq4_m	capsaicin sensitivity related QTL 4 (mouse)			Not determined		8	36630154	93455280	Mouse
1357708	Orq1_m	ovulation rate QTL 1 (mouse)			Not determined		8	71740461	124622354	Mouse
4142023	W3q5_m	weight 3 weeks QTL 5 (mouse)			Not determined			71740461	124622354	Mouse
1558780	Idd22_m	insulin dependent diabetes susceptibility 22 (mouse)			Not determined		8	71829531	105829637	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029746	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC159266	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ459718	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608575	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSMUST00000083510

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	8	84,935,301 - 84,935,387 (+)	Ensembl
GRCm38.p6 Ensembl	8	84,208,672 - 84,208,758 (+)	Ensembl

RefSeq Acc Id:

NR_029746

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	8	84,935,301 - 84,935,387 (+)	NCBI
GRCm38	8	84,208,672 - 84,208,758 (+)	ENTREZGENE
MGSCv37	8	86,732,571 - 86,732,657 (+)	RGD
Celera	8	88,508,778 - 88,508,864 (+)	RGD
cM Map	8		ENTREZGENE

Sequence:

show sequence

TGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAAGTCGTGTTCACAGTG
GCTAAGTTCCGCCCCCTGGACCC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676902	AgrOrtholog
Ensembl Genes	ENSMUSG00000065444	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083510	ENTREZGENE
MGD	MGI:2676902	ENTREZGENE
miRBase	MI0000578	ENTREZGENE
NCBI Gene	387220	ENTREZGENE
PhenoGen	Mir27a	PhenoGen
RNAcentral	URS00001B341F	RNACentral
	URS00003B95DA	RNACentral
	URS000075AEFF	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD