Mir30b (microRNA 30b) - Rat Genome Database

Name: Mir30b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir30b (microRNA 30b) Mus musculus

Analyze

Symbol:

Mir30b

Name:

microRNA 30b

RGD ID:

1607660

MGI Page

MGI

Description:

Is expressed in gut; limb; and liver. Orthologous to human MIR30B (microRNA 30b).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-30b; Mirn; Mirn30b; mmu-mir-3; mmu-mir-30b

RGD Orthologs

Human

Rat

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	68,209,264 - 68,209,359 (-)	NCBI	GRCm39		mm39
GRCm39 Ensembl	15	68,209,264 - 68,209,359 (-)	Ensembl
GRCm38	15	68,337,415 - 68,337,510 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	68,337,415 - 68,337,510 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	15	68,168,977 - 68,169,072 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	15	69,853,459 - 69,853,554 (-)	NCBI		Celera
Cytogenetic Map	15	D2	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

adult respiratory distress syndrome (ISO)

atrial fibrillation (ISO)

Cardiomegaly (ISO)

Chemical and Drug Induced Liver Injury (ISO)

colorectal cancer (ISO)

Experimental Liver Neoplasms (ISO)

liver cirrhosis (ISO)

pancreatitis (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(+)-schisandrin B (ISO)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

benzene (EXP)

benzo[a]pyrene (ISO)

bleomycin A2 (ISO)

cadmium dichloride (ISO)

cisplatin (ISO)

dibutyl phthalate (ISO)

formaldehyde (EXP)

hydrogen peroxide (ISO)

microcystin-LR (ISO)

paracetamol (ISO)

paraquat (ISO)

sodium arsenite (EXP,ISO)

tetrachloromethane (EXP,ISO)

toluene (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular hyperosmotic salinity response (IDA)

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

regulation of gene expression (IDA)

response to bacterium (IEP)

response to oxygen levels (IDA)

sensory perception of sound (IEP)

References

References - curated


1.	Liao WT, etal., J Pathol. 2014 Mar;232(4):415-27. doi: 10.1002/path.4309.
2.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:12007417	PMID:15538371	PMID:16369549	PMID:16381832	PMID:16882971	PMID:17028171	PMID:17369397	PMID:17604727	PMID:17936263	PMID:18452032	PMID:18762567	PMID:19185580
PMID:19188439	PMID:19416898	PMID:20215419	PMID:20413612	PMID:20708584	PMID:20944551	PMID:21037258	PMID:21267068	PMID:21643937	PMID:21822254	PMID:22227196	PMID:23029204
PMID:23646144	PMID:24006456	PMID:24205035	PMID:24309499	PMID:25301066	PMID:25576051	PMID:25689854	PMID:25763824	PMID:25858512	PMID:26107383	PMID:26590946	PMID:26681446
PMID:27032651	PMID:27182160	PMID:27489163	PMID:27941314	PMID:30087332	PMID:30879769	PMID:31170401	PMID:31199852	PMID:31539668	PMID:32643523

Genomics

Comparative Map Data

Mir30b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	68,209,264 - 68,209,359 (-)	NCBI	GRCm39		mm39
GRCm39 Ensembl	15	68,209,264 - 68,209,359 (-)	Ensembl
GRCm38	15	68,337,415 - 68,337,510 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	68,337,415 - 68,337,510 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	15	68,168,977 - 68,169,072 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	15	69,853,459 - 69,853,554 (-)	NCBI		Celera
Cytogenetic Map	15	D2	NCBI

MIR30B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	8	134,800,520 - 134,800,607 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	8	134,800,520 - 134,800,607 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	8	135,812,763 - 135,812,850 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	8	135,881,944 - 135,882,031 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	8	131,985,504 - 131,985,591 (-)	NCBI
Cytogenetic Map	8	q24.22	NCBI
HuRef	8	131,128,460 - 131,128,547 (-)	NCBI		HuRef
CHM1_1	8	135,854,881 - 135,854,968 (-)	NCBI		CHM1_1

Mir30b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	7	100,132,589 - 100,132,675 (-)	NCBI
Rnor_6.0 Ensembl	7	109,282,658 - 109,282,752 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	7	109,282,662 - 109,282,747 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Celera	7	96,643,845 - 96,643,931 (-)	NCBI		Celera
Cytogenetic Map	7	q34	NCBI

MIR30B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	13	30,906,038 - 30,906,097 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	13	30,906,038 - 30,906,097 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

MIR30B
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	4	6,952,794 - 6,952,869 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	4	6,952,794 - 6,952,869 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	4	6,717,643 - 6,717,718 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10401902	Sicd2_m	seizure-induced cell death 2 (mouse)			Not determined		15	3444907	71325689	Mouse
4141952	W3q7_m	weight 3 weeks QTL 7 (mouse)			Not determined			3460212	78717086	Mouse
4142448	Tailq6_m	tail length QTL 6 (mouse)			Not determined			3460212	78717086	Mouse
4142252	Tailaq4_m	tail length adjusted QTL 4 (mouse)			Not determined			3460212	78717086	Mouse
1357559	Scfq2_m	subcutaneous fat pad weight QTL 2 (mouse)			Not determined		15	3460212	78717086	Mouse
1357659	Epfpq4_m	epididymal fat percentage QTL 4 (mouse)			Not determined		15	3460212	78717086	Mouse
26884387	Skwq8_m	skull length QTL 8, 10 week (mouse)					15	6100000	68400000	Mouse
26884412	Bzwq10_m	bi-zygomatic width QTL 10, 10 week (mouse)					15	6100000	71600000	Mouse
26884417	Bzwq4_m	bi-zygomatic width QTL 4, 5 week (mouse)					15	6100000	72600000	Mouse
27226786	Feml11_m	femur length 11, 5 week (mouse)					15	6100000	76000000	Mouse
27095932	Ulnl11_m	ulna length 11, 16 week (mouse)					15	6100000	76500000	Mouse
27226717	Tibw4_m	tibia width 4, proximal, 10 week (mouse)					15	6100000	78800000	Mouse
27226734	Tibmd5_m	tibia midshaft diameter 5, 10 week (mouse)					15	6100000	86800000	Mouse
26884442	Sklq6_m	skull length QTL 6, 5 week (mouse)					15	6100000	100900000	Mouse
27226721	Tibw8_m	tibia width 8, proximal, 16 week (mouse)					15	6900000	76000000	Mouse
27226773	Tibl16_m	tibia length 16, 10 week (mouse)					15	6900000	76000000	Mouse
27226777	Tibl8_m	tibia length 8, 5 week (mouse)					15	6900000	84700000	Mouse
1301433	Rapop5_m	radiation-induced apoptosis 5 (mouse)			Not determined		15	9272936	79590561	Mouse
1357526	Hyplip2_m	hyperlipidemia 2 (mouse)			Not determined		15	12402117	102988123	Mouse
26884425	Cvht2_m	cranial vault height 2, 5 week (mouse)					15	28800000	102100000	Mouse
26884392	Humsd8_m	humerus midshaft diameter 8, 16 week (mouse)					15	29300000	76200000	Mouse
1558985	Eae32_m	experimental allergic encephalomyelitis susceptibility 32 (mouse)			Not determined		15	32578270	103517472	Mouse
1301324	Cdif_m	color difference (mouse)			Not determined		15	36112510	70112623	Mouse
27226729	Tibmd2_m	tibia midshaft diameter 2, 5 week (mouse)					15	38000000	86800000	Mouse
1301580	Hrq2_m	heart rate quantitative locus 2 (mouse)			Not determined		15	39236999	73237197	Mouse
4142459	Lfnq3_m	lung function QTL 3 (mouse)			Not determined			40313626	72500731	Mouse
26884402	Cvht9_m	cranial vault height 9, 16 week (mouse)					15	42300000	95600000	Mouse
1300644	Fob3_m	F-line obesity QTL 3 (mouse)	11.3		Not determined		15	44144438	89377036	Mouse
1357703	Vtbt17_m	vertebral trabecular bone trait 17 (mouse)			Not determined		15	44681464	78681588	Mouse
1301568	Tria2_m	T-cell receptor induced activation 2 (mouse)			Not determined		15	44987292	78987432	Mouse
26884420	Cvht6_m	cranial vault height 6, 10 week (mouse)					15	45700000	69300000	Mouse
1357756	Alaa4_m	alopecia areata 4 (mouse)			Not determined		15	46517797	80517996	Mouse
10755515	Amzn3_m	anatomical modifier of Zfp423 3 (mouse)					15	46517797	80517996	Mouse
1301006	Hfib1_m	hepatic fibrogenesis 1 (mouse)			Not determined		15	47434485	81434630	Mouse
1301860	Gct3_m	granulosa cell tumorigenesis 3 (mouse)			Not determined		15	47537747	81537842	Mouse
26884397	Humsd5_m	humerus midshaft diameter 5, 10 week (mouse)					15	48500000	98500000	Mouse
26884399	Humsd1_m	humerus midshaft diameter 1, 5 week (mouse)					15	48500000	101800000	Mouse
1301429	Pcir3_m	periosteal circumference 3 (mouse)			Not determined		15	48593513	82593647	Mouse
1301779	Dpml_m	dopamine loss (mouse)			Not determined		15	51141298	76910293	Mouse
4142198	Hbtq_m	habituation QTL (mouse)			Not determined		15	51288859	85288984	Mouse
10045637	Heal27_m	wound healing/regeneration 29 (mouse)			Not determined		15	51546512	85546662	Mouse
10412067	Pain2_m	pain 2 (mouse)			Not determined		15	51773490	85773777	Mouse
1302080	Szs13_m	seizure susceptibility 13 (mouse)			Not determined		15	51813983	85822600	Mouse
1301708	Cocrb14_m	cocaine related behavior 14 (mouse)			Not determined		15	51934666	85934802	Mouse
38501067	Tip3_m	tuberculosis immunophenotype 3, IFN-g level (mouse)					15	53700000	89700000	Mouse
13504731	Cath5_m	carotid atherosclerosis 5 (mouse)					15	54917280	88917280	Mouse
1302074	Bmd4_m	bone mineral density 4 (mouse)			Not determined		15	56323312	103517472	Mouse
27095936	Ulnl4_m	ulna length 4, 5 week (mouse)					15	56900000	87800000	Mouse
1300800	Ses3_m	salmonella enteritidis susceptibility 3 (mouse)			Not determined		15	57245156	91245304	Mouse
1357407	Pfat4_m	predicted fat percentage 4 (mouse)	8.6		Body fat amount	predicted fat percentage	15	57245156	91245304	Mouse
12880420	V25Dq8_m	vitamin D inactive form serum level QTL 8 (mouse)					15	61700000	95700000	Mouse
1301601	Faq9_m	fluctuating asymmetry QTL 9 (mouse)			Not determined		15	63279702	97279794	Mouse
1558786	Msq1_m	MAV-1 susceptibility QTL 1 (mouse)			Not determined		15	63517797	81202235	Mouse
1302197	Bhr2_m	bronchial hyperresponsiveness 2 (mouse)			Not determined		15	64434485	103517472	Mouse
4141135	Cia35_m	collagen induced arthritis 35 (mouse)			Not determined		15	64927625	98927745	Mouse
1301119	Drb7_m	dopamine receptor binding 7 (mouse)			Not determined		15	65452377	99456827	Mouse
1301171	Brm2_m	brachyury modifier 2 (mouse)			Not determined		15	65641175	99641298	Mouse
4141921	Pstc3_m	periosteal circumference 3 (mouse)			Not determined		15	67386497	101386646	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Aicda	mmu-miR-30b-5p	Mirtarbase	external_info	qRT-PCR	Non-Functional MTI (Weak)	18762567
Casp3	mmu-miR-30b-5p	OncomiRDB	external_info	NA	NA	22964638
Ccne2	mmu-miR-30b-5p	OncomiRDB	external_info	NA	NA	22384020
Bcl2l11	mmu-miR-30b-5p	OncomiRDB	external_info	NA	NA	22157681
Galnt7	mmu-miR-30b-5p	OncomiRDB	external_info	NA	NA	21741600
Myb	mmu-miR-30b-5p	OncomiRDB	external_info	NA	NA	21187425
Ube2i	mmu-miR-30b-5p	OncomiRDB	external_info	NA	NA	20498642

Predicted Targets

	Summary Value
Count of predictions:	25022
Count of gene targets:	9839
Count of transcripts:	16265
Interacting mature miRNAs:	mmu-miR-30b-3p, mmu-miR-30b-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029534	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC108821	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ459725	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608228	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083542

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	15	68,337,415 - 68,337,510 (-)	Ensembl

RefSeq Acc Id:

NR_029534

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	15	68,209,264 - 68,209,359 (-)	NCBI
GRCm38	15	68,337,415 - 68,337,510 (-)	ENTREZGENE
MGSCv37	15	68,168,977 - 68,169,072 (-)	RGD
Celera	15	69,853,459 - 69,853,554 (-)	RGD
cM Map	15		ENTREZGENE

Sequence:

show sequence

CTAAGCCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCTGTCATACATGCGTTGGCTGGGA
TGTGGATGTTTACGTCAGCTGTCTTGGAGTAT

hide sequence

Promoters

RGD ID:

8683896

Promoter ID:

EPDNEW_M19979

Type:

single initiation site

Name:

Mir30b_1

Description:

Mus musculus microRNA 30b , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	15	68,337,429 - 68,337,489	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676908	AgrOrtholog
Ensembl Genes	ENSMUSG00000065476	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083542	ENTREZGENE
MGD	MGI:2676908	ENTREZGENE
miRBase	MI0000145	ENTREZGENE
NCBI Gene	387226	ENTREZGENE
PhenoGen	Mir30b	PhenoGen
RNAcentral	URS00005165DA	RNACentral
	URS00005E5FB5	RNACentral
	URS000075C557	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD