Mir542 (microRNA 542) - Rat Genome Database

Name: Mir542
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir542 (microRNA 542) Mus musculus

Analyze

Symbol:

Mir542

Name:

microRNA 542

RGD ID:

1607620

MGI Page

MGI

Description:

Involved in cellular response to leukemia inhibitory factor; hematopoietic stem cell differentiation; and sensory perception of sound. Orthologous to human MIR542 (microRNA 542).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-542; Mirn; Mirn542; mmu-mir-5; mmu-mir-542

RGD Orthologs

Human

Rat

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	52,138,280 - 52,138,364 (-)	NCBI	GRCm39		mm39
GRCm38	X	53,049,403 - 53,049,487 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	53,049,403 - 53,049,487 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	50,402,580 - 50,402,664 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	40,475,386 - 40,475,470 (-)	NCBI		Celera
Cytogenetic Map	X	A5	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

astroblastoma (ISO)

autistic disorder (ISO)

fatty liver disease (ISO)

Myocardial Reperfusion Injury (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2,5-hexanedione (ISO)

atrazine (ISO)

benzene (EXP)

bis(2-ethylhexyl) phthalate (ISO)

bleomycin A2 (ISO)

cadmium atom (EXP)

cadmium dichloride (EXP)

choline (ISO)

doxorubicin (ISO)

hydrogen peroxide (ISO)

L-methionine (ISO)

mono(2-ethylhexyl) phthalate (EXP)

ochratoxin A (ISO)

p-cresol (EXP)

perfluorooctane-1-sulfonic acid (ISO)

phenol (EXP)

potassium bromate (ISO)

progesterone (ISO)

resveratrol (ISO)

sodium fluoride (EXP)

titanium dioxide (EXP)

tributyl phosphate (EXP)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to leukemia inhibitory factor (IEP)

hematopoietic stem cell differentiation (IDA)

sensory perception of sound (IEP)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:16274478	PMID:16381832	PMID:16582102	PMID:16973894	PMID:17604727	PMID:18184563	PMID:20215419	PMID:20413612	PMID:20439489	PMID:20660734	PMID:21037258	PMID:21267068
PMID:21822254	PMID:23646144	PMID:24403060	PMID:24503542	PMID:30216510	PMID:30368874	PMID:30467286	PMID:31080058

Genomics

Comparative Map Data

Mir542
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	52,138,280 - 52,138,364 (-)	NCBI	GRCm39		mm39
GRCm38	X	53,049,403 - 53,049,487 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	53,049,403 - 53,049,487 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	50,402,580 - 50,402,664 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	40,475,386 - 40,475,470 (-)	NCBI		Celera
Cytogenetic Map	X	A5	NCBI

MIR542
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	X	134,541,341 - 134,541,437 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	X	134,541,341 - 134,541,437 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	X	133,675,371 - 133,675,467 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	X	133,503,036 - 133,503,132 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	X	134,062,199 - 134,062,295 (-)	NCBI
Cytogenetic Map	X	q26.3	NCBI
HuRef	X	123,074,367 - 123,074,463 (-)	NCBI		HuRef
CHM1_1	X	133,587,121 - 133,587,217 (-)	NCBI		CHM1_1

Mir542
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	X	132,802,623 - 132,802,701 (-)	NCBI
Rnor_6.0 Ensembl	X	158,152,146 - 158,152,224 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	X	158,152,146 - 158,152,224 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	X	152,777,453 - 152,777,531 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Cytogenetic Map	X	q37	NCBI

MIR542
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	X	110,382,597 - 110,382,676 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	X	110,382,597 - 110,382,676 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357433	Dbts2_m	diabetes 2 (mouse)			Not determined		X	7360056	151324042	Mouse
13208553	Wght11_m	weight 11 (mouse)					X	12000000	60000000	Mouse
13208557	Lgth13_m	body length 13 (mouse)					X	12000000	60000000	Mouse
27226750	Femd9_m	femur midshaft diameter 9, 10 week (mouse)					X	33900000	56800000	Mouse
27226780	Femd12_m	femur midshaft diameter 12, 16 week (mouse)					X	35400000	57800000	Mouse
13208567	Bmiq12_m	body mass index QTL 12 (mouse)					X	36000000	78000000	Mouse
4141565	Pbwg21_m	postnatal body weight growth 21 (mouse)			Not determined		X	40068354	74068454	Mouse
1301009	Pbwg7_m	postnatal body weight growth 7 (mouse)			Not determined		X	40068354	74068454	Mouse
1300794	Spha2_m	sperm head anomaly 2 (mouse)			Not determined		X	40832621	87216531	Mouse
4142200	Rtwq1_m	reduced testis weight QTL 1 (mouse)			Not determined			42431700	76431843	Mouse
1301278	Bdln1_m	body length 1 (mouse)			Not determined		X	42656746	76656858	Mouse
1300702	Fcsa4_m	femoral cross-sectional area 4 (mouse)			Not determined		X	46983838	80983961	Mouse
1301212	Bw19_m	body weight QTL 19 (mouse)			Not determined		X	47288043	53323450	Mouse
4141630	Gct6_m	granulosa cell tumorigenesis 6 (mouse)			Not determined			48090244	130864007	Mouse
1300853	Aggr2_m	aggression 2 (mouse)			Not determined		X	49982290	53170319	Mouse
1301351	Obq6_m	obesity QTL 6 (mouse)			Not determined		X	51683498	71391145	Mouse
25314311	Syncl3_m	synaptonemal complex length 3 (mouse)					X	52900000	90700000	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Egfr	mmu-miR-542-5p	OncomiRDB	external_info	NA	NA	22426479
Ilk	mmu-miR-542-3p	OncomiRDB	external_info	NA	NA	21860426
Birc5	mmu-miR-542-3p	OncomiRDB	external_info	NA	NA	20728447

Predicted Targets

	Summary Value
Count of predictions:	23061
Count of gene targets:	10459
Count of transcripts:	17590
Interacting mature miRNAs:	mmu-miR-542-3p, mmu-miR-542-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_030264	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BX649621	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609534	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000102186

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	X	53,049,403 - 53,049,487 (-)	Ensembl

RefSeq Acc Id:

NR_030264

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	X	52,138,280 - 52,138,364 (-)	NCBI
GRCm38	X	53,049,403 - 53,049,487 (-)	ENTREZGENE
MGSCv37	X	50,402,580 - 50,402,664 (-)	RGD
Celera	X	40,475,386 - 40,475,470 (-)	RGD
cM Map	X		ENTREZGENE

Sequence:

show sequence

GGATCTCAGACGTCTCGGGGATCATCATGTCACGAGATACCACTGTGCCCTTGTGACAGATTGA
TAACTGAAAGGTCTGGGAGCC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619431	AgrOrtholog
Ensembl Genes	ENSMUSG00000076140	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000102186	ENTREZGENE
MGD	MGI:3619431	ENTREZGENE
miRBase	MI0003522	ENTREZGENE
NCBI Gene	723901	ENTREZGENE
PhenoGen	Mir542	PhenoGen
RNAcentral	URS00001AF64C	RNACentral
	URS00004F859B	RNACentral
	URS000069971F	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD