Mir542 (microRNA 542) - Rat Genome Database

Name: Mir542
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir542 (microRNA 542) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir542

Name:

microRNA 542

Description:

Involved in cellular response to leukemia inhibitory factor; hematopoietic stem cell differentiation; and sensory perception of sound.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-542; Mirn542; mmu-mir-542

Orthologs:

Homo sapiens (human) : MIR542 (microRNA 542) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir542 (microRNA 542) Alliance
Sus scrofa (pig) : MIR542 (microRNA mir-542)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR542 (microRNA 542)	HGNC	HGNC
Rattus norvegicus (Norway rat):	Mir542 (microRNA 542)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MIR542 (microRNA mir-542)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	X	53,049,403 - 53,049,487 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	X	50,402,580 - 50,402,664 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	40,475,386 - 40,475,470 (-)	NCBI		Celera
Cytogenetic Map	X	A5	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
autistic disorder		ISO	RGD:1606043	8554872	ClinVar Annotator: match by term: Autistic disorder of childhood onset	ClinVar	PMID:21681106, PMID:30208311

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
fatty liver disease		ISO	RGD:1606043	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22363424
Myocardial Reperfusion Injury		ISO	RGD:1606043	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22050707

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
17beta-estradiol	multiple interactions	ISO	RGD:1606043	6480464	[Progesterone co-treated with Estradiol] results in decreased expression of MIR542 mRNA	CTD	PMID:22950660
2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	RGD:1606043	6480464	Tetrachlorodibenzodioxin results in increased expression of MIR542 mRNA	CTD	PMID:30096437
bis(2-ethylhexyl) phthalate	affects expression	ISO	RGD:2325422	6480464	Diethylhexyl Phthalate affects the expression of MIR542 mRNA	CTD	PMID:28192093
bleomycin A2	decreases expression	ISO	RGD:2325422	6480464	Bleomycin results in decreased expression of MIR542 mRNA	CTD	PMID:25933445
choline	multiple interactions	ISO	RGD:2325422	6480464	[Methionine deficiency co-treated with Choline deficiency] results in decreased expression of MIR542 mRNA alternative form	CTD	PMID:22363424
doxorubicin	increases expression	ISO	RGD:1606043	6480464	Doxorubicin results in increased expression of MIR542 mRNA	CTD	PMID:26842497
hydrogen peroxide	increases expression	ISO	RGD:1606043	6480464	Hydrogen Peroxide results in increased expression of MIR542 mRNA	CTD	PMID:26339600
L-methionine	multiple interactions	ISO	RGD:2325422	6480464	[Methionine deficiency co-treated with Choline deficiency] results in decreased expression of MIR542 mRNA alternative form	CTD	PMID:22363424
ochratoxin A	increases expression	ISO	RGD:1606043	6480464	ochratoxin A results in increased expression of MIR542 mRNA	CTD	PMID:30559759
perfluorooctane-1-sulfonic acid	increases expression	ISO	RGD:2325422	6480464	perfluorooctane sulfonic acid results in increased expression of MIR542 mRNA	CTD	PMID:24420840
potassium bromate	decreases expression	ISO	RGD:1606043	6480464	potassium bromate results in decreased expression of MIR542 mRNA	CTD	PMID:30559759
progesterone	multiple interactions	ISO	RGD:1606043	6480464	[Progesterone co-treated with Estradiol] results in decreased expression of MIR542 mRNA	CTD	PMID:22950660
resveratrol	decreases expression	ISO	RGD:2325422	6480464	Resveratrol results in decreased expression of MIR542 mRNA	CTD	PMID:22050707
resveratrol	multiple interactions	ISO	RGD:2325422	6480464	[plastochromanol 8 co-treated with Resveratrol] results in decreased expression of MIR542 mRNA more ...	CTD	PMID:22050707
sodium fluoride	increases expression	EXP		6480464	Sodium Fluoride results in increased expression of MIR542 mRNA	CTD	PMID:29127033
titanium dioxide	increases expression	EXP		6480464	titanium dioxide results in increased expression of MIR542 mRNA	CTD	PMID:29247641
zinc atom	decreases expression	ISO	RGD:2325422	6480464	Zinc deficiency results in decreased expression of MIR542 mRNA	CTD	PMID:22689922
zinc(0)	decreases expression	ISO	RGD:2325422	6480464	Zinc deficiency results in decreased expression of MIR542 mRNA	CTD	PMID:22689922

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to leukemia inhibitory factor		IEP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
hematopoietic stem cell differentiation		IDA		2290270	(MGI:MGI:4822501, PMID:20660734)	MGI	MGI:MGI:4822501, PMID:20660734
sensory perception of sound		IEP		2290270	(MGI:MGI:5508842, PMID:23646144)	MGI	MGI:MGI:5508842, PMID:23646144

Disease Annotations

	autistic disorder (ISO)
	fatty liver disease (ISO)

Myocardial Reperfusion Injury (ISO)

Gene-Chemical Interaction Annotations

	17beta-estradiol (ISO)
	2,3,7,8-tetrachlorodibenzodioxine (ISO)
	bis(2-ethylhexyl) phthalate (ISO)
	bleomycin A2 (ISO)
	choline (ISO)
	doxorubicin (ISO)

	hydrogen peroxide (ISO)
	L-methionine (ISO)
	ochratoxin A (ISO)
	perfluorooctane-1-sulfonic acid (ISO)
	potassium bromate (ISO)
	progesterone (ISO)

	resveratrol (ISO)
	sodium fluoride (EXP)
	titanium dioxide (EXP)
	zinc atom (ISO)
	zinc(0) (ISO)

Gene Ontology Annotations

Biological Process

	cellular response to leukemia inhibitory factor (IEP)
	hematopoietic stem cell differentiation (IDA)

sensory perception of sound (IEP)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

16274478 16381832 16582102 16973894 17604727 18184563 20215419 20413612 20439489 20660734 21037258 21267068 21822254 23646144 24403060 24503542 30467286

Genomics

Comparative Map Data

Mir542
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	X	53,049,403 - 53,049,487 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	X	50,402,580 - 50,402,664 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	40,475,386 - 40,475,470 (-)	NCBI		Celera
Cytogenetic Map	X	A5	NCBI

MIR542
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	X	134,541,341 - 134,541,437 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	X	133,675,371 - 133,675,467 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	X	133,503,036 - 133,503,132 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	X	134,062,199 - 134,062,295 (-)	NCBI
Cytogenetic Map	X	q26.3	NCBI
HuRef	X	123,074,367 - 123,074,463 (-)	NCBI		HuRef
CHM1_1	X	133,587,121 - 133,587,217 (-)	NCBI		CHM1_1

Mir542
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	X	158,152,146 - 158,152,224 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	158,152,146 - 158,152,224 (+)	Ensembl
Rnor_5.0	X	152,777,453 - 152,777,531 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Cytogenetic Map	X	q37	NCBI

MIR542
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1	X	110,382,597 - 110,382,676 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Pig Cytomap	X		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357433	Dbts2_m	diabetes 2 (mouse)			Not determined		X	7360056	151324042	Mouse
13208553	Wght11_m	weight 11 (mouse)					X	12000000	60000000	Mouse
13208557	Lgth13_m	body length 13 (mouse)					X	12000000	60000000	Mouse
13208567	Bmiq12_m	body mass index QTL 12 (mouse)					X	36000000	78000000	Mouse
4141565	Pbwg21_m	postnatal body weight growth 21 (mouse)			Not determined		X	40068354	74068454	Mouse
1301009	Pbwg7_m	postnatal body weight growth 7 (mouse)			Not determined		X	40068354	74068454	Mouse
1300794	Spha2_m	sperm head anomaly 2 (mouse)			Not determined		X	40832621	87216531	Mouse
4142200	Rtwq1_m	reduced testis weight QTL 1 (mouse)			Not determined			42431700	76431843	Mouse
1301278	Bdln1_m	body length 1 (mouse)			Not determined		X	42656746	76656858	Mouse
1300702	Fcsa4_m	femoral cross-sectional area 4 (mouse)			Not determined		X	46983838	80983961	Mouse
1301212	Bw19_m	body weight QTL 19 (mouse)			Not determined		X	47288043	53323450	Mouse
4141630	Gct6_m	granulosa cell tumorigenesis 6 (mouse)			Not determined			48090244	130864007	Mouse
1300853	Aggr2_m	aggression 2 (mouse)			Not determined		X	49982290	53170319	Mouse
1301351	Obq6_m	obesity QTL 6 (mouse)			Not determined		X	51683498	71391145	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Egfr	mmu-miR-542-5p	OncomiRDB	external_info	NA	NA	22426479
Ilk	mmu-miR-542-3p	OncomiRDB	external_info	NA	NA	21860426
Birc5	mmu-miR-542-3p	OncomiRDB	external_info	NA	NA	20728447

Predicted Targets

	Summary Value
Count of predictions:	22320
Count of gene targets:	9793
Count of transcripts:	16901
Interacting mature miRNAs:	mmu-miR-542-3p, mmu-miR-542-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_030264	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BX649621	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609534	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_030264

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	X	53,049,403 - 53,049,487 (-)	ENTREZGENE
MGSCv37	X	50,402,580 - 50,402,664 (-)	RGD
Celera	X	40,475,386 - 40,475,470 (-)	RGD
cM Map	X		ENTREZGENE

Sequence:

show sequence

GGATCTCAGACGTCTCGGGGATCATCATGTCACGAGATACCACTGTGCCCTTGTGACAGATTGA
TAACTGAAAGGTCTGGGAGCC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000076140	ENTREZGENE
Ensembl Transcript	ENSMUST00000102186	ENTREZGENE
MGD	MGI:3619431	ENTREZGENE
miRBase	MI0003522	ENTREZGENE
NCBI Gene	723901	ENTREZGENE
PhenoGen	Mir542	PhenoGen
RNAcentral	URS00001AF64C	RNACentral
	URS00004F859B	RNACentral
	URS000069971F	RNACentral

More on Mir542
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1607620
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-01
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.