Mir335 (microRNA 335) - Rat Genome Database

Name: Mir335
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir335 (microRNA 335) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir335

Name:

microRNA 335

Description:

Involved in cellular response to leukemia inhibitory factor and response to oxygen levels. Is expressed in several structures, including branchial arch; gut; limb bud; lung; and retina.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-335; Mirn335; mmu-mir-335

Orthologs:

Homo sapiens (human) : MIR335 (microRNA 335) HGNC
Canis lupus familiaris (dog) : MIR335 (microRNA mir-335)
Sus scrofa (pig) : MIR335 (microRNA mir-335)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR335 (microRNA 335)	HGNC	HGNC
Canis lupus familiaris (dog):	MIR335 (microRNA mir-335)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MIR335 (microRNA mir-335)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	6	30,741,299 - 30,741,396 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	6	30,691,299 - 30,691,396 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	30,751,223 - 30,751,321 (+)	NCBI		Celera
Cytogenetic Map	6	A3.3	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

RGD Manual Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Lymphatic Metastasis		ISO	RGD:1350498	14394425	associated with stomach cancer, RNA:decreased expression:stomach	RGD
Neoplasm Metastasis		ISO	RGD:1350498	14394425	lung metastasis	RGD
stomach cancer	severity	ISO	RGD:1350498	14394425		RGD

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
pleomorphic xanthoastrocytoma		ISO	RGD:1350498	8554872	ClinVar Annotator: match by term: Pleomorphic xanthoastrocytoma	ClinVar	PMID:28299358

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Chemical and Drug Induced Liver Injury		ISO	RGD:1350498	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106
Experimental Liver Neoplasms		ISO	RGD:1350498	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:21035526
Myocardial Reperfusion Injury		ISO	RGD:1350498	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22050707
pancreatitis		ISO	RGD:1350498	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27840954
type 2 diabetes mellitus		ISO	RGD:1350498	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
1,3,5-trinitro-1,3,5-triazinane	decreases expression	EXP		6480464	cyclonite results in decreased expression of MIR335 mRNA modified form	CTD	PMID:19270793
2,3,7,8-tetrachlorodibenzodioxine	multiple interactions	ISO	RGD:1350498	6480464	AHR protein promotes the reaction [Tetrachlorodibenzodioxin results in increased expression of MIR335 mRNA], Tetrachlorodibenzodioxin promotes the reaction [[MIR335 mRNA binds to SOX4 3' UTR] which results in decreased expression of SOX4 mRNA]	CTD	PMID:22034498
2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	RGD:1350498	6480464	Tetrachlorodibenzodioxin results in increased expression of MIR335 mRNA	CTD	PMID:22034498, PMID:30096437
aflatoxin B1	multiple interactions	ISO	RGD:1350498	6480464	[CYP2A13 protein co-treated with Aflatoxin B1] results in increased expression of MIR335 mRNA	CTD	PMID:26084420
arsenous acid	increases expression	ISO	RGD:1350498	6480464	Arsenic Trioxide results in increased expression of MIR335 mRNA	CTD	PMID:22072212
bis(2-chloroethyl) sulfide	decreases expression	EXP		6480464	Mustard Gas results in decreased expression of MIR335 mRNA	CTD	PMID:26456178
bisphenol A	increases expression	ISO	RGD:1350498	6480464	bisphenol A results in increased expression of MIR335 mRNA	CTD	PMID:20417706
decabromodiphenyl ether	increases expression	ISO	RGD:1350498	6480464	decabromobiphenyl ether results in increased expression of MIR335 mRNA	CTD	PMID:26206603
diarsenic trioxide	increases expression	ISO	RGD:1350498	6480464	Arsenic Trioxide results in increased expression of MIR335 mRNA	CTD	PMID:22072212
hydrogen peroxide	increases expression	ISO	RGD:1350498	6480464	Hydrogen Peroxide results in increased expression of MIR335 mRNA	CTD	PMID:26339600
paracetamol	increases expression	ISO	RGD:1350498	6480464	Acetaminophen results in increased expression of MIR335 mRNA	CTD	PMID:28545106
progesterone	increases expression	ISO	RGD:1350498	6480464	Progesterone results in increased expression of MIR335 mRNA	CTD	PMID:22950660
sodium fluoride	decreases expression	EXP		6480464	Sodium Fluoride results in decreased expression of MIR335 mRNA	CTD	PMID:29127033
zirconium atom	affects expression	ISO	RGD:1350498	6480464	Zirconium affects the expression of MIR335 mRNA	CTD	PMID:27611787

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to leukemia inhibitory factor		IEP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
response to oxygen levels		IDA		2290270	(MGI:MGI:3807359 more ...	MGI	MGI:MGI:3807359 more ...

Disease Annotations

	Chemical and Drug Induced Liver Injury (ISO)
	Experimental Liver Neoplasms (ISO)
	Lymphatic Metastasis (ISO)
	Myocardial Reperfusion Injury (ISO)

	Neoplasm Metastasis (ISO)
	pancreatitis (ISO)
	pleomorphic xanthoastrocytoma (ISO)
	stomach cancer (ISO)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations

	1,3,5-trinitro-1,3,5-triazinane (EXP)
	2,3,7,8-tetrachlorodibenzodioxine (ISO)
	aflatoxin B1 (ISO)
	arsenous acid (ISO)
	bis(2-chloroethyl) sulfide (EXP)

	bisphenol A (ISO)
	decabromodiphenyl ether (ISO)
	diarsenic trioxide (ISO)
	hydrogen peroxide (ISO)
	paracetamol (ISO)

	progesterone (ISO)
	sodium fluoride (EXP)
	zirconium atom (ISO)

Gene Ontology Annotations

Biological Process

	cellular response to leukemia inhibitory factor (IEP)
	response to oxygen levels (IDA)

References - curated

1.	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
2.	RGD automated import pipeline for gene-chemical interactions
3.	Xu Y, etal., Oncogene. 2012 Mar 15;31(11):1398-407. doi: 10.1038/onc.2011.340. Epub 2011 Aug 8.

References - uncurated

PubMed

14691248 15634332 16381832 17369397 17597072 17604727 17687032 17936263 18282110 18452032 18723672 19188439 19460359 19559694 19933188 20215419 20413612 20439489 21037258 21267068 21351149 21822254 22144232 22950940 23307555 24347469 24449834 24744440 26098312 26107383 26986081 27191548 28039088 28846804 29734116 29866515 30125687 30537731 30578296

Genomics

Comparative Map Data

Mir335
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	6	30,741,299 - 30,741,396 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	6	30,691,299 - 30,691,396 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	30,751,223 - 30,751,321 (+)	NCBI		Celera
Cytogenetic Map	6	A3.3	NCBI

MIR335
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	7	130,496,111 - 130,496,204 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	7	130,135,952 - 130,136,045 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	7	129,923,187 - 129,923,280 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	7	124,931,728 - 124,931,821 (+)	NCBI
Cytogenetic Map	7	q32.2	NCBI
HuRef	7	124,498,447 - 124,498,540 (+)	NCBI		HuRef
CHM1_1	7	130,069,373 - 130,069,466 (+)	NCBI		CHM1_1
CRA_TCAGchr7v2	7	129,521,359 - 129,521,452 (+)	NCBI

MIR335
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	14	6,444,861 - 6,444,918 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	14		NCBI

MIR335
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1	18	18,341,580 - 18,341,659 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	18	19,338,000 - 19,338,079 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3
Pig Cytomap	18		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301131	Chol2_m	cholesterol 2 (mouse)			Not determined		6	1	32144496	Mouse
5491191	Mobq2_m	multigenic obesity QTL 2 (mouse)			Not determined		6	1	32144496	Mouse
1302024	Skull7_m	skull morphology 7 (mouse)			Not determined		6	1	32144496	Mouse
1300731	Smdq3_m	segregation of mitochondrial DNA QTL 3 (mouse)			Not determined		6	4249207	38249326	Mouse
1300556	Cia6_m	collagen induced arthritis QTL 6 (mouse)			Not determined		6	4464884	87426034	Mouse
11353840	Bmiq2_m	body mass index QTL 2 (mouse)					6	4503823	45314181	Mouse
1357481	Aaj2_m	anxiety in A/J 2 (mouse)			Not determined		6	4503823	48726677	Mouse
1357520	Axtq2_m	anxiety QTL 2 (mouse)			Not determined		6	4503823	48726677	Mouse
11353841	Bmiq3_m	body mass index QTL 3 (mouse)					6	4503823	48726677	Mouse
4142126	W3q3_m	weight 3 weeks QTL 3 (mouse)			Not determined			4503823	96656149	Mouse
4142361	W10q11_m	weight 10 weeks QTL 11 (mouse)			Not determined			4503823	96656149	Mouse
4142271	Egq8_m	early growth QTL 8 (mouse)			Not determined			4503823	96656149	Mouse
4142232	W6q4_m	weight 6 weeks QTL 4 (mouse)			Not determined			4503823	96656149	Mouse
1302051	Sluc7_m	susceptibility to lung cancer 7 (mouse)			Not determined		6	9297075	43297169	Mouse
10043869	Cia6a_m	collagen induced arthritis QTL 6a (mouse)			Not determined		6	12117972	46118070	Mouse
1301998	Bts2_m	bladder tumor susceptibility 2 (mouse)			Not determined		6	12751222	46751334	Mouse
4141749	Obrq2_m	obesity resistance QTL 2 (mouse)			Not determined			12751222	46751334	Mouse
1301724	Pcd4ts1_m	p-glycoprotein positive CD4 T cell subset 1 (mouse)			Not determined		6	17734663	51734784	Mouse
4140989	Spqq2_m	sperm quality QTL 2 (mouse)			Not determined			17734663	51734784	Mouse
1301850	Fglu_m	fasting glucose (mouse)			Not determined		6	17734663	51734784	Mouse
1357442	Dbts1_m	diabetes 1 (mouse)			Not determined		6	18234148	73387692	Mouse
12904940	Edlmmq5_m	extensor digitorum longus muscle mass QTL 5 (mouse)					6	19639411	53639411	Mouse
12904943	Tammq4_m	tibialis anterior muscle mass QTL 4 (mouse)					6	19639411	53639411	Mouse
12904952	Gmmq4_m	gastrocnemius muscle mass QTL 4 (mouse)					6	19639411	53639411	Mouse
10412213	Sxbq2_m	SGC/Knj cross B6 QTL 2 (mouse)			Not determined		6	19912686	71322775	Mouse
10412107	Desp4_m	despair 4 (mouse)			Not determined		6	20072895	54072895	Mouse
14700690	Ccs6_m	colon cancer susceptibility 6 (mouse)					6	23800000	57800000	Mouse
13208564	Bmiq7_m	body mass index QTL 7 (mouse)					6	25000000	80000000	Mouse
4141988	Obrq3_m	obesity resistance QTL 3 (mouse)			Not determined			28314059	62314181	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Rb1	mmu-miR-335-5p	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	20713524
Rock1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	22382496
Bcl2l2	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	21822301
Esr1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	21618216
Daam1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	21592405
Rb1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	20713524
Tnnc1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	18185580

Predicted Targets

	Summary Value
Count of predictions:	28891
Count of gene targets:	10138
Count of transcripts:	17161
Interacting mature miRNAs:	mmu-miR-335-3p, mmu-miR-335-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029900	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC146699	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608735	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029900

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	6	30,741,299 - 30,741,396 (+)	ENTREZGENE
MGSCv37	6	30,691,299 - 30,691,396 (+)	RGD
Celera	6	30,751,223 - 30,751,321 (+)	RGD
cM Map	6		ENTREZGENE

Sequence:

show sequence

TCTTTTGGGCGGGGGTCAAGAGCAATAACGAAAAATGTTTGTTTTTCGTAAACCGTTTTTCATT
ATTGCTCCTGACCCCCTCTCATGGGTTATAGCCA

hide sequence

Promoters

RGD ID:

6889246

Promoter ID:

EPDNEW_M8074

Type:

single initiation site

Name:

Mir335_1

Description:

Mus musculus microRNA 335 , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	6	30,741,377 - 30,741,437	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065501	ENTREZGENE
Ensembl Transcript	ENSMUST00000083567	ENTREZGENE
MGD	MGI:3619348	ENTREZGENE
miRBase	MI0000817	ENTREZGENE
NCBI Gene	723930	ENTREZGENE
PhenoGen	Mir335	PhenoGen
RNAcentral	URS0000237AF9	RNACentral
	URS00005092C2	RNACentral
	URS0000710A73	RNACentral

More on Mir335
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1607592
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-11-13
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.