Mir335 (microRNA 335) - Rat Genome Database

Name: Mir335
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir335 (microRNA 335) Mus musculus

Analyze

Symbol:

Mir335

Name:

microRNA 335

RGD ID:

1607592

MGI Page

MGI

Description:

Is expressed in several structures, including branchial arch; gut; limb bud; lung; and retina. Orthologous to human MIR335 (microRNA 335).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-3; mir-335; Mirn; Mirn335; mmu-mir-3; mmu-mir-335

RGD Orthologs

Human

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	6	30,741,298 - 30,741,395 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	6	30,741,298 - 30,741,395 (+)	Ensembl
GRCm38	6	30,741,299 - 30,741,396 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	6	30,741,299 - 30,741,396 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	6	30,691,299 - 30,691,396 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	30,751,223 - 30,751,321 (+)	NCBI		Celera
Cytogenetic Map	6	A3.3	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Chemical and Drug Induced Liver Injury (ISO)

Experimental Liver Neoplasms (ISO)

Lymphatic Metastasis (ISO)

Myocardial Reperfusion Injury (ISO)

Neoplasm Metastasis (ISO)

pancreatitis (ISO)

pleomorphic xanthoastrocytoma (ISO)

stomach cancer (ISO)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (EXP)

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

aflatoxin B1 (ISO)

arsenous acid (ISO)

bis(2-chloroethyl) sulfide (EXP)

bisphenol A (ISO)

decabromodiphenyl ether (ISO)

diarsenic trioxide (ISO)

hydrogen peroxide (ISO)

paracetamol (ISO)

progesterone (ISO)

sodium fluoride (EXP)

zirconium atom (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to leukemia inhibitory factor (IEP)

response to oxygen levels (IDA)

References

References - curated


1.	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
2.	RGD automated import pipeline for gene-chemical interactions
3.	Xu Y, etal., Oncogene. 2012 Mar 15;31(11):1398-407. doi: 10.1038/onc.2011.340. Epub 2011 Aug 8.

Additional References at PubMed

PMID:14691248	PMID:15634332	PMID:16381832	PMID:17369397	PMID:17597072	PMID:17604727	PMID:17687032	PMID:17936263	PMID:18282110	PMID:18452032	PMID:18723672	PMID:19188439
PMID:19460359	PMID:19559694	PMID:19933188	PMID:20215419	PMID:20413612	PMID:20439489	PMID:21037258	PMID:21267068	PMID:21351149	PMID:21822254	PMID:22144232	PMID:22950940
PMID:23307555	PMID:24347469	PMID:24449834	PMID:24744440	PMID:26098312	PMID:26107383	PMID:26986081	PMID:27191548	PMID:28039088	PMID:28846804	PMID:29734116	PMID:29866515
PMID:30125687	PMID:30341900	PMID:30537731	PMID:30578296	PMID:32015687

Genomics

Comparative Map Data

Mir335
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	6	30,741,298 - 30,741,395 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	6	30,741,298 - 30,741,395 (+)	Ensembl
GRCm38	6	30,741,299 - 30,741,396 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	6	30,741,299 - 30,741,396 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	6	30,691,299 - 30,691,396 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	30,751,223 - 30,751,321 (+)	NCBI		Celera
Cytogenetic Map	6	A3.3	NCBI

MIR335
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	7	130,496,111 - 130,496,204 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	7	130,496,111 - 130,496,204 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	7	130,135,952 - 130,136,045 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	7	129,923,187 - 129,923,280 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	7	124,931,728 - 124,931,821 (+)	NCBI
Cytogenetic Map	7	q32.2	NCBI
HuRef	7	124,498,447 - 124,498,540 (+)	NCBI		HuRef
CHM1_1	7	130,069,373 - 130,069,466 (+)	NCBI		CHM1_1
CRA_TCAGchr7v2	7	129,521,359 - 129,521,452 (+)	NCBI

MIR335
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1 Ensembl	14	6,444,847 - 6,444,932 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
CanFam3.1	14	6,444,861 - 6,444,918 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

MIR335
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	18	18,341,568 - 18,341,659 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	18	18,341,580 - 18,341,659 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	18	19,338,000 - 19,338,079 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301131	Chol2_m	cholesterol 2 (mouse)			Not determined		6	1	32144496	Mouse
5491191	Mobq2_m	multigenic obesity QTL 2 (mouse)			Not determined		6	1	32144496	Mouse
1302024	Skull7_m	skull morphology 7 (mouse)			Not determined		6	1	32144496	Mouse
25440480	Moaq2_m	modifier of alien QTL 2 (mouse)					6	1	117500000	Mouse
15039372	Nmrs22_m	NAFLD-associated magnetic resonance shift 22 (mouse)					6	1476335	35476335	Mouse
26884414	Bzwq12_m	bi-zygomatic width QTL 12, 16 week (mouse)					6	3400000	139100000	Mouse
1300731	Smdq3_m	segregation of mitochondrial DNA QTL 3 (mouse)			Not determined		6	4249207	38249326	Mouse
1300556	Cia6_m	collagen induced arthritis QTL 6 (mouse)			Not determined		6	4464884	87426034	Mouse
11353840	Bmiq2_m	body mass index QTL 2 (mouse)					6	4503823	45314181	Mouse
1357481	Aaj2_m	anxiety in A/J 2 (mouse)			Not determined		6	4503823	48726677	Mouse
1357520	Axtq2_m	anxiety QTL 2 (mouse)			Not determined		6	4503823	48726677	Mouse
11353841	Bmiq3_m	body mass index QTL 3 (mouse)					6	4503823	48726677	Mouse
4142126	W3q3_m	weight 3 weeks QTL 3 (mouse)			Not determined			4503823	96656149	Mouse
4142361	W10q11_m	weight 10 weeks QTL 11 (mouse)			Not determined			4503823	96656149	Mouse
4142271	Egq8_m	early growth QTL 8 (mouse)			Not determined			4503823	96656149	Mouse
4142232	W6q4_m	weight 6 weeks QTL 4 (mouse)			Not determined			4503823	96656149	Mouse
26884441	Sklq3_m	skull length QTL 3, 5 week (mouse)					6	7600000	80600000	Mouse
1302051	Sluc7_m	susceptibility to lung cancer 7 (mouse)			Not determined		6	9297075	43297169	Mouse
10043869	Cia6a_m	collagen induced arthritis QTL 6a (mouse)			Not determined		6	12117972	46118070	Mouse
1301998	Bts2_m	bladder tumor susceptibility 2 (mouse)			Not determined		6	12751222	46751334	Mouse
4141749	Obrq2_m	obesity resistance QTL 2 (mouse)			Not determined			12751222	46751334	Mouse
27226726	Tibmd7_m	tibia midshaft diameter 7, 16 week (mouse)					6	17700000	53500000	Mouse
1301724	Pcd4ts1_m	p-glycoprotein positive CD4 T cell subset 1 (mouse)			Not determined		6	17734663	51734784	Mouse
4140989	Spqq2_m	sperm quality QTL 2 (mouse)			Not determined			17734663	51734784	Mouse
1301850	Fglu_m	fasting glucose (mouse)			Not determined		6	17734663	51734784	Mouse
1357442	Dbts1_m	diabetes 1 (mouse)			Not determined		6	18234148	73387692	Mouse
12904940	Edlmmq5_m	extensor digitorum longus muscle mass QTL 5 (mouse)					6	19639411	53639411	Mouse
12904943	Tammq4_m	tibialis anterior muscle mass QTL 4 (mouse)					6	19639411	53639411	Mouse
12904952	Gmmq4_m	gastrocnemius muscle mass QTL 4 (mouse)					6	19639411	53639411	Mouse
10412213	Sxbq2_m	SGC/Knj cross B6 QTL 2 (mouse)			Not determined		6	19912686	71322775	Mouse
10412107	Desp4_m	despair 4 (mouse)			Not determined		6	20072895	54072895	Mouse
14700690	Ccs6_m	colon cancer susceptibility 6 (mouse)					6	23800000	57800000	Mouse
13208564	Bmiq7_m	body mass index QTL 7 (mouse)					6	25000000	80000000	Mouse
4141988	Obrq3_m	obesity resistance QTL 3 (mouse)			Not determined			28314059	62314181	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Rb1	mmu-miR-335-5p	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	20713524
Rock1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	22382496
Bcl2l2	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	21822301
Esr1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	21618216
Daam1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	21592405
Rb1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	20713524
Tnnc1	mmu-miR-335-5p	OncomiRDB	external_info	NA	NA	18185580

Predicted Targets

	Summary Value
Count of predictions:	29370
Count of gene targets:	10570
Count of transcripts:	17601
Interacting mature miRNAs:	mmu-miR-335-3p, mmu-miR-335-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029900	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC146699	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608735	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000083567

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	6	30,741,299 - 30,741,396 (+)	Ensembl

RefSeq Acc Id:

NR_029900

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	6	30,741,298 - 30,741,395 (+)	NCBI
GRCm38	6	30,741,299 - 30,741,396 (+)	ENTREZGENE
MGSCv37	6	30,691,299 - 30,691,396 (+)	RGD
Celera	6	30,751,223 - 30,751,321 (+)	RGD
cM Map	6		ENTREZGENE

Sequence:

show sequence

TCTTTTGGGCGGGGGTCAAGAGCAATAACGAAAAATGTTTGTTTTTCGTAAACCGTTTTTCATT
ATTGCTCCTGACCCCCTCTCATGGGTTATAGCCA

hide sequence

Promoters

RGD ID:

6889246

Promoter ID:

EPDNEW_M8074

Type:

single initiation site

Name:

Mir335_1

Description:

Mus musculus microRNA 335 , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	6	30,741,377 - 30,741,437	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619348	AgrOrtholog
Ensembl Genes	ENSMUSG00000065501	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083567	ENTREZGENE
MGD	MGI:3619348	ENTREZGENE
miRBase	MI0000817	ENTREZGENE
NCBI Gene	723930	ENTREZGENE
PhenoGen	Mir335	PhenoGen
RNAcentral	URS0000237AF9	RNACentral
	URS00005092C2	RNACentral
	URS0000710A73	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD