Mir471 (microRNA 471) - Rat Genome Database

Name: Mir471
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir471 (microRNA 471) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir471

Name:

microRNA 471

Description:

Involved in female sex differentiation.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-471; Mirn471; mmu-mir-471

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	X	66,792,595 - 66,792,661 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	X	64,045,770 - 64,045,836 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	X	54,980,389 - 54,980,455 (+)	NCBI		Celera
Cytogenetic Map	X	A7.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
streptozocin	increases expression	EXP		6480464	Streptozocin results in increased expression of MIR471 mRNA	CTD	PMID:27629361

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
female sex differentiation		IEP		2290270	(MGI:MGI:5528923, PMID:23946534)	MGI	MGI:MGI:5528923, PMID:23946534

Gene-Chemical Interaction Annotations

streptozocin (EXP)

Gene Ontology Annotations

Biological Process

female sex differentiation (IEP)

References - uncurated

PubMed

15901636 16381832 16766679 17604727 20215419 20413612 21037258 21267068 23946534 28928467

Genomics

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300702	Fcsa4_m	femoral cross-sectional area 4 (mouse)			Not determined		X	46983838	80983961	Mouse
1301351	Obq6_m	obesity QTL 6 (mouse)			Not determined		X	51683498	71391145	Mouse
1300794	Spha2_m	sperm head anomaly 2 (mouse)			Not determined		X	40832621	87216531	Mouse
1301278	Bdln1_m	body length 1 (mouse)			Not determined		X	42656746	76656858	Mouse
1301009	Pbwg7_m	postnatal body weight growth 7 (mouse)			Not determined		X	40068354	74068454	Mouse
1357433	Dbts2_m	diabetes 2 (mouse)			Not determined		X	7360056	151324042	Mouse
4141630	Gct6_m	granulosa cell tumorigenesis 6 (mouse)			Not determined			48090244	130864007	Mouse
4142200	Rtwq1_m	reduced testis weight QTL 1 (mouse)			Not determined			42431700	76431843	Mouse
4141565	Pbwg21_m	postnatal body weight growth 21 (mouse)			Not determined		X	40068354	74068454	Mouse
10412108	Desp5_m	despair 5 (mouse)			Not determined		X	55678745	89678745	Mouse
12050071	Hstx2_m	hybrid sterility, X chromosome 2 (mouse)					X	64880641	69581094	Mouse
13208567	Bmiq12_m	body mass index QTL 12 (mouse)					X	36000000	78000000	Mouse
13464140	Hdlq108_m	HDL QTL 108 (mouse)					X	58728354	92728354	Mouse
13824980	Ferq1_m	genetic fertility QTL 1 (mouse)					X	55000000	150000000	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Foxd1	mmu-miR-471-5p	Mirtarbase	external_info	Immunohistochemistry//Luciferase reporter assay//q	Functional MTI	22911753

Predicted Targets

	Summary Value
Count of predictions:	12264
Count of gene targets:	5603
Count of transcripts:	8954
Interacting mature miRNAs:	mmu-miR-471-3p, mmu-miR-471-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_030154	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL731773	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609394	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_030154

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	X	66,792,595 - 66,792,661 (-)	ENTREZGENE
MGSCv37	X	64,045,770 - 64,045,836 (-)	RGD
Celera	X	54,980,389 - 54,980,455 (+)	RGD
cM Map	X		ENTREZGENE

Sequence:

show sequence

GTGCTTTACGTAGTATAGTGCTTTTCACATTAAACAAAAAGTGAAAGGTGCCATACTATGTATA
GGA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000070104	ENTREZGENE
Ensembl Transcript	ENSMUST00000093596	ENTREZGENE
MGD	MGI:3619419	ENTREZGENE
miRBase	MI0002406	ENTREZGENE
NCBI Gene	723939	ENTREZGENE
PhenoGen	Mir471	PhenoGen
RNAcentral	URS000044CC4C	RNACentral
	URS000049EC18	RNACentral
	URS000075D577	RNACentral

More on Mir471
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1607583
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-11-27
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.