Mir24-2 (microRNA 24-2) - Rat Genome Database

Name: Mir24-2
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir24-2 (microRNA 24-2) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir24-2

Name:

microRNA 24-2

Description:

Exhibits mRNA 3'-UTR binding activity. Involved in several processes, including cellular response to leukemia inhibitory factor; cellular response to phenylalanine; and long-term synaptic potentiation. Is expressed in cerebellum; gut; pancreas; and telencephalon.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-24-2; Mirn24-2

Orthologs:

Homo sapiens (human) : MIR24-2 (microRNA 24-2) HGNC Alliance
Rattus norvegicus (Norway rat) : Mir24-2 (microRNA 24-2) Alliance
Canis lupus familiaris (dog) : MIR24-2 (microRNA mir-24-2)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR24-2 (microRNA 24-2)	HGNC	HGNC
Rattus norvegicus (Norway rat):	Mir24-2 (microRNA 24-2)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR24-2 (microRNA mir-24-2)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	8	84,208,815 - 84,208,921 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	8	86,732,714 - 86,732,820 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	8	88,508,899 - 88,509,005 (+)	NCBI		Celera
Cytogenetic Map	8	C2	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Breast Neoplasms		ISO	RGD:1344925	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:21463514

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
betulinic acid	multiple interactions	ISO	RGD:1344925	6480464	MIR24-2 mRNA affects the susceptibility to [betulinic acid co-treated with gemcitabine]	CTD	PMID:25841339
betulinic acid	affects response to substance	ISO	RGD:1344925	6480464	MIR24-2 mRNA affects the susceptibility to betulinic acid	CTD	PMID:25841339
bleomycin A2	decreases expression	ISO	RGD:2325349	6480464	Bleomycin results in decreased expression of MIR24-2 mRNA	CTD	PMID:25933445
buta-1,3-diene	increases expression	EXP		6480464	1, 3-butadiene results in increased expression of MIR24-2 mRNA	CTD	PMID:29038090
cisplatin	increases response to substance	ISO	RGD:1344925	6480464	MIR24-2 results in increased susceptibility to Cisplatin	CTD	PMID:21463514
copper atom	increases expression	ISO	RGD:2325349	6480464	Copper results in increased expression of MIR24-2 mRNA, Copper results in increased expression of MIR3074 mRNA	CTD	PMID:30556269
copper(0)	increases expression	ISO	RGD:2325349	6480464	Copper results in increased expression of MIR24-2 mRNA, Copper results in increased expression of MIR3074 mRNA	CTD	PMID:30556269
copper(2+)	increases expression	ISO	RGD:2325349	6480464	Copper results in increased expression of MIR24-2 mRNA, Copper results in increased expression of MIR3074 mRNA	CTD	PMID:30556269
gemcitabine	multiple interactions	ISO	RGD:1344925	6480464	MIR24-2 mRNA affects the susceptibility to [betulinic acid co-treated with gemcitabine]	CTD	PMID:25841339
hydrogen peroxide	increases response to substance	ISO	RGD:1344925	6480464	MIR24-2 results in increased susceptibility to Hydrogen Peroxide	CTD	PMID:21463514
nitrofen	increases expression	ISO	RGD:2325349	6480464	nitrofen results in increased expression of MIR24-2 mRNA	CTD	PMID:26720608
sodium arsenite	increases expression	EXP		6480464	sodium arsenite results in increased expression of MIR24-2 mRNA	CTD	PMID:24896083

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cell aging		IDA		2290270	(MGI:MGI:5643971, PMID:25751060)	MGI	MGI:MGI:5643971, PMID:25751060
cellular response to leukemia inhibitory factor		IEP		2290270	(MGI:MGI:4822296, PMID:20439489)	MGI	MGI:MGI:4822296, PMID:20439489
cellular response to lipopolysaccharide		IDA		2290270	(MGI:MGI:3817382, PMID:18762567)	MGI	MGI:MGI:3817382, PMID:18762567
cellular response to phenylalanine		IEP		2290270	(MGI:MGI:5818415, PMID:26822703)	MGI	MGI:MGI:5818415, PMID:26822703
long-term synaptic potentiation		IEP		2290270	(MGI:MGI:5645435, PMID:25858512)	MGI	MGI:MGI:5645435, PMID:25858512
myelination		IDA		2290270	(MGI:MGI:4830414, PMID:20805985)	MGI	MGI:MGI:4830414, PMID:20805985
negative regulation of gene expression		IDA		2290270	(MGI:MGI:5604962, PMID:24824656)	MGI	MGI:MGI:5604962, PMID:24824656
positive regulation of angiogenesis		IMP		2290270	(MGI:MGI:5002393, PMID:21536891)	MGI	MGI:MGI:5002393, PMID:21536891
positive regulation of cell population proliferation		IMP		2290270	(MGI:MGI:5604962, PMID:24824656)	MGI	MGI:MGI:5604962, PMID:24824656
regulation of viral genome replication		IMP		2290270	(MGI:MGI:3718936, PMID:17613256)	MGI	MGI:MGI:3718936, PMID:17613256
regulation of viral genome replication		IDA		2290270	(MGI:MGI:3718936, PMID:17613256)	MGI	MGI:MGI:3718936, PMID:17613256
retina vasculature development in camera-type eye		IMP		2290270	(MGI:MGI:5002393, PMID:21536891)	MGI	MGI:MGI:5002393, PMID:21536891
sensory perception of sound		IEP		2290270	(MGI:MGI:5508842, PMID:23646144)	MGI	MGI:MGI:5508842, PMID:23646144

Molecular Function

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
mRNA 3'-UTR binding		IDA		2290270	(MGI:MGI:5604962, PMID:24824656)	MGI	MGI:MGI:5604962, PMID:24824656
mRNA 3'-UTR binding		IMP		2290270	(MGI:MGI:5604962, PMID:24824656)	MGI	MGI:MGI:5604962, PMID:24824656

Disease Annotations

Breast Neoplasms (ISO)

Gene-Chemical Interaction Annotations

	betulinic acid (ISO)
	bleomycin A2 (ISO)
	buta-1,3-diene (EXP)
	cisplatin (ISO)

	copper atom (ISO)
	copper(0) (ISO)
	copper(2+) (ISO)
	gemcitabine (ISO)

	hydrogen peroxide (ISO)
	nitrofen (ISO)
	sodium arsenite (EXP)

Gene Ontology Annotations

Biological Process

	cell aging (IDA)
	cellular response to leukemia inhibitory factor (IEP)
	cellular response to lipopolysaccharide (IDA)
	cellular response to phenylalanine (IEP)
	long-term synaptic potentiation (IEP)
	myelination (IDA)
	negative regulation of gene expression (IDA)

	positive regulation of angiogenesis (IMP)
	positive regulation of cell population proliferation (IMP)
	regulation of viral genome replication (IDA,IMP)
	retina vasculature development in camera-type eye (IMP)
	sensory perception of sound (IEP)

Molecular Function

mRNA 3'-UTR binding (IDA,IMP)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

12007417 12554860 12919684 15538371 16381832 16682203 16766679 16882971 17369397 17604727 17613256 17726050 17936263 18311128 18346711 18762567 20019669 20215419 20413612 20439489 20805985 20807761 20980664 21037258 21267068 21536891 21718763 22132122 22564414 22844247 23071155 23307820 23315977 23322776 23418360 23646144 23761103 23825366 24049083 24301787 24651435 24824656 25519956 25751060 25858512 26540574 26822703 26834155 27625395 28400445 28404635 28973913 29407889 29787826 30242124

Genomics

Comparative Map Data

Mir24-2
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	8	84,208,815 - 84,208,921 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	8	86,732,714 - 86,732,820 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	8	88,508,899 - 88,509,005 (+)	NCBI		Celera
Cytogenetic Map	8	C2	NCBI

MIR24-2
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	13,836,287 - 13,836,359 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	19	13,947,101 - 13,947,173 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	13,808,100 - 13,808,172 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	19	13,840,849 - 13,840,921 (-)	NCBI
Cytogenetic Map	19	p13.12	NCBI
HuRef	19	13,518,669 - 13,518,741 (-)	NCBI		HuRef
CHM1_1	19	13,947,606 - 13,947,678 (-)	NCBI		CHM1_1

Mir24-2
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	19	25,318,863 - 25,318,970 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	19	25,318,863 - 25,318,970 (+)	Ensembl
Rnor_5.0	19	36,295,051 - 36,295,158 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	19	23,503,531 - 23,503,638 (-)	NCBI		Celera
Cytogenetic Map	19	q11	NCBI

MIR24-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	20	48,620,684 - 48,620,745 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	20		NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4140967	Bmd39_m	bone mineral density 39 (mouse)			Not determined		8	32016544	117238700	Mouse
1558875	Eae31_m	experimental allergic encephalomyelitis susceptibility 31 (mouse)			Not determined		8	34642776	114837007	Mouse
1301013	Capsq4_m	capsaicin sensitivity related QTL 4 (mouse)			Not determined		8	36163000	92728652	Mouse
12904744	Carcdq1_m	cardiac collagen deposition QTL 1 (mouse)					8	39709256	94689598	Mouse
14700686	Civq3_m	cerebral infarct volume QTL 3 (mouse)					8	51882191	85882191	Mouse
1301506	Aevm1_m	autoimmune extremity vasculitis in MRL mice 1 (mouse)			Not determined		8	54287817	88287993	Mouse
1301952	Im3_m	immunoregulatory 3 (mouse)			Not determined		8	54706614	88706763	Mouse
10412287	Carg3_m	Candida albicans resistance gene 3 (mouse)			Not determined		8	55545028	89545028	Mouse
11353828	Gf7_m	gonadal fat pad weight 7 (mouse)					8	58201479	92201479	Mouse
10043975	Obq31_m	obesity QTL 31 (mouse)			Not determined		8	58409776	92409776	Mouse
1301688	Orch6_m	autoimmune orchitis resistance 6 (mouse)			Not determined		8	60786850	94786976	Mouse
4141285	Tgq18_m	triglyceride QTL 18 (mouse)			Not determined			63460107	97460107	Mouse
4141797	Skmw16_m	skeletal muscle weight 16 (mouse)			Not determined		8	63939547	97939696	Mouse
1357787	Vtbt5_m	vertebral trabecular bone trait 5 (mouse)			Not determined		8	65357768	99357920	Mouse
10043992	Hbnr11_m	Heligmosomoides bakeri nematode resistance 11 (mouse)			Not determined		8	65600207	99600347	Mouse
1301767	Fcsa2_m	femoral cross-sectional area 2 (mouse)			Not determined		8	70305375	104305495	Mouse
4142283	Imraq2_m	immune response to AAV2 QTL 2 (mouse)			Not determined		8	70305375	104305495	Mouse
1558780	Idd22_m	insulin dependent diabetes susceptibility 22 (mouse)			Not determined		8	71102903	105103009	Mouse
4141395	Char2a_m	P. chabaudi malaria resistance QTL 2a (mouse)			Not determined			71136783	90202598	Mouse
4142023	W3q5_m	weight 3 weeks QTL 5 (mouse)			Not determined			71287817	123895615	Mouse
1357708	Orq1_m	ovulation rate QTL 1 (mouse)			Not determined		8	71287817	123895615	Mouse
1301872	Cd4ts3_m	CD4 T cell subset 3 (mouse)			Not determined		8	71396181	105396393	Mouse
1300920	Pitm3_m	prion incubation time 3 (mouse)			Not determined		8	73202495	107202598	Mouse
1558890	Lith18_m	lithogenic gene 18 (mouse)			Not determined		8	75675517	109675623	Mouse
1357470	Obq16_m	obesity QTL 16 (mouse)			Not determined		8	75685348	109685497	Mouse
1301808	Nhdlq1_m	non-HDL QTL 1 (mouse)			Not determined		8	75685348	109685497	Mouse
1301874	Hdlq16_m	HDL QTL 16 (mouse)			Not determined		8	75685348	109685497	Mouse
10412234	Nhdlq14_m	non-HDL QTL 14 (mouse)			Not determined		8	75685348	109685497	Mouse
1301099	Cbm2_m	cerebellum weight 2 (mouse)			Not determined		8	78518613	112518703	Mouse
1301581	Char2_m	P. chabaudi malaria resistance QTL 2 (mouse)			Not determined		8	79082178	113082403	Mouse
12904012	Cfq10_m	conditioned fear QTL 10 (mouse)					8	80066775	89014359	Mouse
10755530	Wbc2_m	white blood cell count 2 (mouse)					8	81092664	115092664	Mouse
10755519	Wbc1_m	white blood cell count 1 (mouse)					8	81619151	115619151	Mouse

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Ece1	mmu-miR-24-3p	Tarbase	external_info	Sequencing	POSITIVE
Mlec	mmu-miR-24-3p	Tarbase	external_info	Reporter Gene	NEGATIVE
Myef2	mmu-miR-24-3p	Tarbase	external_info	qPCR	POSITIVE
Myef2	mmu-miR-24-3p	Tarbase	external_info	Westernblit	POSITIVE
Ptpn9	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	23418360
Xiap	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	22733138
Hnf4a	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	22153071
S100a8	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	22139384
Furin	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	21402698
Dnd1	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	20816961
Faf1	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	20195546
Dusp16	mmu-miR-24-3p	OncomiRDB	external_info	NA	NA	19826043
Prkca	mmu-miR-24-2-5p	OncomiRDB	external_info	NA	NA	22911661
Apba1	mmu-miR-24-3p	Mirtarbase	external_info	Western blot;qRT-PCR	Functional MTI	18353861
Smad3	mmu-miR-24-3p	Mirtarbase	external_info	In situ hybridization//Luciferase reporter assay//	Functional MTI	19582816
Smad3	mmu-miR-24-3p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	19536157
Ankrd52	mmu-miR-24-3p	Mirtarbase	external_info	Sequencing	Functional MTI (Weak)	18353861

Predicted Targets

	Summary Value
Count of predictions:	27143
Count of gene targets:	11094
Count of transcripts:	20586
Interacting mature miRNAs:	mmu-miR-24-2-5p, mmu-miR-24-3p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_029741	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC159266	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608570	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_029741

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	8	84,208,815 - 84,208,921 (+)	ENTREZGENE
MGSCv37	8	86,732,714 - 86,732,820 (+)	RGD
Celera	8	88,508,899 - 88,509,005 (+)	RGD
cM Map	8		ENTREZGENE

Sequence:

show sequence

GCCTCTCTCCGGGCTCCGCCTCCCGTGCCTACTGAGCTGAAACAGTTGATTCCAGTGCACTGGC
TCAGTTCAGCAGGAACAGGAGTCCAGCCCCCTAGGAGCTGGCA

hide sequence

Promoters

RGD ID:

8667655

Promoter ID:

EPDNEW_M11859

Type:

single initiation site

Name:

Mir24-2_1

Description:

Mus musculus microRNA 24-2 (Mir24-2), microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	8	84,208,898 - 84,208,958	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000065541	ENTREZGENE
Ensembl Transcript	ENSMUST00000083607	ENTREZGENE
MGD	MGI:3618755	ENTREZGENE
miRBase	MI0000572	ENTREZGENE
NCBI Gene	723960	ENTREZGENE
PhenoGen	Mir24-2	PhenoGen
RNAcentral	URS00001C4513	RNACentral
	URS000059273E	RNACentral
	URS000075D181	RNACentral

More on Mir24-2
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm9 mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	1607563
Created:	2007-04-29
Species:	Mus musculus
Last Modified:	2019-10-01
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.