USH1C (USH1 protein network component harmonin) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: USH1C (USH1 protein network component harmonin) Homo sapiens
Analyze
Symbol: USH1C
Name: USH1 protein network component harmonin
RGD ID: 1604645
HGNC Page HGNC:12597
Description: Enables spectrin binding activity. Involved in several processes, including brush border assembly; photoreceptor cell maintenance; and protein localization to microvillus. Located in several cellular components, including apical part of cell; brush border; and microvillus. Implicated in Usher syndrome; Usher syndrome type 1; Usher syndrome type 1C; and autosomal recessive nonsyndromic deafness 18A.
Type: protein-coding
RefSeq Status: REVIEWED
Previously known as: AIE-75; antigen NY-CO-38/NY-CO-37; autoimmune enteropathy-related antigen AIE-75; DFNB18; DFNB18A; harmonin; NY-CO-37; NY-CO-38; PDZ-45; PDZ-73; PDZ-73/NY-CO-38; PDZ73; PDZD7C; renal carcinoma antigen NY-REN-3; truncated Usher syndrome typeIC; ush1cpst; Usher syndrome 1C (autosomal recessive, severe); usher syndrome type-1C protein
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh381117,493,900 - 17,544,416 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl1117,493,895 - 17,544,416 (-)EnsemblGRCh38hg38GRCh38
GRCh371117,515,447 - 17,565,963 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361117,472,018 - 17,522,539 (-)NCBINCBI36hg18NCBI36
Celera1117,645,289 - 17,695,946 (-)NCBI
Cytogenetic Map11p15.1NCBI
HuRef1117,199,243 - 17,249,828 (-)NCBIHuRef
CHM1_11117,515,265 - 17,565,784 (-)NCBICHM1_1
T2T-CHM13v2.01117,591,495 - 17,642,149 (-)NCBI
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene Ontology Annotations     Click to see Annotation Detail View

Cellular Component

Molecular Function

Molecular Pathway Annotations     Click to see Annotation Detail View
References

References - curated
# Reference Title Reference Citation
1. Deafblindness in French Canadians from Quebec: a predominant founder mutation in the USH1C gene provides the first genetic link with the Acadian population. Ebermann I, etal., Genome Biol. 2007;8(4):R47.
2. Mechanotransduction by hair cells: models, molecules, and mechanisms. Gillespie PG and Muller U, Cell. 2009 Oct 2;139(1):33-44. doi: 10.1016/j.cell.2009.09.010.
3. Mouse models of USH1C and DFNB18: phenotypic and molecular analyses of two new spontaneous mutations of the Ush1c gene. Johnson KR, etal., Hum Mol Genet. 2003 Dec 1;12(23):3075-86. Epub 2003 Sep 30.
4. Sensing sound: molecules that orchestrate mechanotransduction by hair cells. Kazmierczak P and Muller U, Trends Neurosci. 2012 Apr;35(4):220-9. doi: 10.1016/j.tins.2011.10.007. Epub 2011 Dec 15.
5. Exome sequencing identifies a founder frameshift mutation in an alternative exon of USH1C as the cause of autosomal recessive retinitis pigmentosa with late-onset hearing loss. Khateb S, etal., PLoS One. 2012;7(12):e51566. doi: 10.1371/journal.pone.0051566. Epub 2012 Dec 12.
6. Deafness and retinal degeneration in a novel USH1C knock-in mouse model. Lentz JJ, etal., Dev Neurobiol. 2010 Mar;70(4):253-67. doi: 10.1002/dneu.20771.
7. Rescue of hearing and vestibular function by antisense oligonucleotides in a mouse model of human deafness. Lentz JJ, etal., Nat Med. 2013 Mar;19(3):345-50. doi: 10.1038/nm.3106. Epub 2013 Feb 4.
8. OMIM Disease Annotation Pipeline OMIM Disease Annotation Pipeline
9. Mutations in the alternatively spliced exons of USH1C cause non-syndromic recessive deafness. Ouyang XM, etal., Hum Genet. 2002 Jul;111(1):26-30. Epub 2002 Jun 18.
10. ClinVar Automated Import and Annotation Pipeline RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
11. Data Import for Chemical-Gene Interactions RGD automated import pipeline for gene-chemical interactions
12. RGD HPO Phenotype Annotation Pipeline RGD automated import pipeline for human HPO-to-gene-to-disease annotations
13. Mutations in the USH1C gene associated with sector retinitis pigmentosa and hearing loss. Saihan Z, etal., Retina. 2011 Sep;31(8):1708-16. doi: 10.1097/IAE.0b013e31820d3fd1.
14. Ush1c gene expression levels in the ear and eye suggest different roles for Ush1c in neurosensory organs in a new Ush1c knockout mouse. Tian C, etal., Brain Res. 2010 Apr 30;1328:57-70. doi: 10.1016/j.brainres.2010.02.079. Epub 2010 Mar 6.
15. A defect in harmonin, a PDZ domain-containing protein expressed in the inner ear sensory hair cells, underlies Usher syndrome type 1C. Verpy E, etal., Nat Genet. 2000 Sep;26(1):51-5.
16. Photoreceptor degeneration: genetic and mechanistic dissection of a complex trait. Wright AF, etal., Nat Rev Genet. 2010 Apr;11(4):273-84. doi: 10.1038/nrg2717.
17. Identification of three novel mutations in the USH1C gene and detection of thirty-one polymorphisms used for haplotype analysis. Zwaenepoel I, etal., Hum Mutat. 2001;17(1):34-41.
Additional References at PubMed
PMID:8125298   PMID:9610721   PMID:9653658   PMID:9760205   PMID:10209257   PMID:10500064   PMID:10508479   PMID:10973248   PMID:11311560   PMID:11398101   PMID:11810303   PMID:12107438  
PMID:12407180   PMID:12477932   PMID:12485990   PMID:12588794   PMID:12665801   PMID:14759258   PMID:15219944   PMID:15461667   PMID:15489334   PMID:15578223   PMID:15660226   PMID:16301216  
PMID:16464467   PMID:16713569   PMID:18484607   PMID:19297620   PMID:19683999   PMID:20142502   PMID:20301442   PMID:20301607   PMID:20379614   PMID:20801516   PMID:21203349   PMID:21330445  
PMID:21873635   PMID:22219650   PMID:22661463   PMID:22810586   PMID:22879593   PMID:22939629   PMID:23665419   PMID:23704327   PMID:24250806   PMID:24416283   PMID:24618850   PMID:24725409  
PMID:25416956   PMID:25502805   PMID:26264872   PMID:26812017   PMID:26812018   PMID:26871637   PMID:27107014   PMID:27173435   PMID:27440999   PMID:27503909   PMID:28031293   PMID:28439001  
PMID:28514442   PMID:28653419   PMID:28660889   PMID:29997244   PMID:30021884   PMID:31515488   PMID:31644917   PMID:32296183   PMID:32814053   PMID:33231815   PMID:33961781  


Genomics

Comparative Map Data
USH1C
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh381117,493,900 - 17,544,416 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl1117,493,895 - 17,544,416 (-)EnsemblGRCh38hg38GRCh38
GRCh371117,515,447 - 17,565,963 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361117,472,018 - 17,522,539 (-)NCBINCBI36hg18NCBI36
Celera1117,645,289 - 17,695,946 (-)NCBI
Cytogenetic Map11p15.1NCBI
HuRef1117,199,243 - 17,249,828 (-)NCBIHuRef
CHM1_11117,515,265 - 17,565,784 (-)NCBICHM1_1
T2T-CHM13v2.01117,591,495 - 17,642,149 (-)NCBI
Ush1c
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39745,844,774 - 45,887,984 (-)NCBIGRCm39mm39
GRCm39 Ensembl745,844,774 - 45,887,927 (-)Ensembl
GRCm38746,195,350 - 46,238,490 (-)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl746,195,350 - 46,238,503 (-)EnsemblGRCm38mm10GRCm38
MGSCv37753,450,721 - 53,493,860 (-)NCBIGRCm37mm9NCBIm37
MGSCv36746,063,399 - 46,106,532 (-)NCBImm8
Celera741,668,925 - 41,712,073 (-)NCBICelera
Cytogenetic Map7B3NCBI
cM Map729.66NCBI
Ush1c
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.2196,695,303 - 96,743,671 (-)NCBImRatBN7.2
mRatBN7.2 Ensembl196,695,307 - 96,743,671 (-)Ensembl
Rnor_6.01102,207,096 - 102,256,779 (-)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl1102,207,096 - 102,255,459 (-)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.01103,291,318 - 103,340,928 (-)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.4196,720,185 - 96,768,550 (-)NCBIRGSC3.4rn4RGSC3.4
RGSC_v3.1196,798,295 - 96,846,661 (-)NCBI
Celera190,943,948 - 90,992,307 (-)NCBICelera
Cytogenetic Map1q22NCBI
Ush1c
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_00495541432,298,759 - 32,351,505 (-)EnsemblChiLan1.0
ChiLan1.0NW_00495541432,303,045 - 32,351,401 (-)NCBIChiLan1.0ChiLan1.0
USH1C
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.11117,233,854 - 17,284,256 (-)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl1117,233,854 - 17,284,256 (-)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v01117,548,501 - 17,598,923 (-)NCBIMhudiblu_PPA_v0panPan3
USH1C
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.12140,055,786 - 40,100,685 (-)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl2140,055,730 - 40,101,430 (-)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha2139,555,651 - 39,600,543 (-)NCBI
ROS_Cfam_1.02141,161,015 - 41,205,900 (-)NCBI
ROS_Cfam_1.0 Ensembl2141,160,539 - 41,205,845 (-)Ensembl
UMICH_Zoey_3.12140,173,714 - 40,218,550 (-)NCBI
UNSW_CanFamBas_1.02140,380,893 - 40,425,786 (-)NCBI
UU_Cfam_GSD_1.02140,719,734 - 40,764,634 (-)NCBI
Ush1c
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_02440494745,513,303 - 45,560,765 (+)NCBI
SpeTri2.0NW_0049365281,552,175 - 1,594,740 (+)NCBISpeTri2.0SpeTri2.0SpeTri2.0
USH1C
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl241,593,802 - 41,647,247 (+)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.1241,593,793 - 41,646,777 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.2244,613,841 - 44,706,204 (+)NCBISscrofa10.2Sscrofa10.2susScr3
USH1C
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1147,428,181 - 47,477,578 (+)NCBIChlSab1.1chlSab2
ChlSab1.1 Ensembl147,437,596 - 47,477,834 (+)EnsemblChlSab1.1chlSab2
Vero_WHO_p1.0NW_023666038144,848,688 - 144,898,245 (+)NCBIVero_WHO_p1.0
Ush1c
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla_female_1.0 EnsemblNW_0046247669,105,990 - 9,153,663 (-)EnsemblHetGla_female_1.0hetGla2
HetGla 1.0NW_0046247669,097,466 - 9,153,602 (-)NCBIHetGla_female_1.0hetGla2

Position Markers
G59975  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371117,538,678 - 17,538,783UniSTSGRCh37
Build 361117,495,254 - 17,495,359RGDNCBI36
Celera1117,668,527 - 17,668,632RGD
Cytogenetic Map11p14.3UniSTS
HuRef1117,222,481 - 17,222,586UniSTS
TNG Radiation Hybrid Map118570.0UniSTS
G54591  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371117,538,673 - 17,538,873UniSTSGRCh37
Celera1117,668,522 - 17,668,722UniSTS
Cytogenetic Map11p14.3UniSTS
HuRef1117,222,476 - 17,222,676UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:2830
Count of miRNA genes:819
Interacting mature miRNAs:996
Transcripts:ENST00000005226, ENST00000318024, ENST00000526181, ENST00000526313, ENST00000527020, ENST00000527551, ENST00000527720, ENST00000529563, ENST00000530700, ENST00000534556
Prediction methods:Miranda, Rnahybrid, Targetscan
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system adipose tissue appendage entire extraembryonic component
High
Medium 641 6 126 45 128 47 1 391 260 35 35
Low 860 97 777 146 73 146 287 60 2243 65 540 585 2 55 85 1
Below cutoff 875 2241 741 375 593 238 3130 1751 928 53 741 803 139 875 2196 1

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_011883 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001297764 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_005709 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_153676 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NR_123738 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_011519832 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_011519834 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_017017072 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_017017073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_017017074 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_017017075 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047426219 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047426220 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047426221 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_047426222 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XR_001747717 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XR_930841 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XR_930842 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB006955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB018687 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB839143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB839144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC124799 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF039699 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF039700 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024943 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK225614 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK290788 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK300936 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL711953 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC016057 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BK000147 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX641129 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CP068267 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KF455327 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KU178498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KU178499 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  MT900254 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000005226   ⟹   ENSP00000005226
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,900 - 17,544,416 (-)Ensembl
RefSeq Acc Id: ENST00000318024   ⟹   ENSP00000317018
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,900 - 17,544,416 (-)Ensembl
RefSeq Acc Id: ENST00000526181   ⟹   ENSP00000437128
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,522,883 - 17,533,874 (-)Ensembl
RefSeq Acc Id: ENST00000526313   ⟹   ENSP00000432236
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,895 - 17,544,402 (-)Ensembl
RefSeq Acc Id: ENST00000527020   ⟹   ENSP00000436934
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,900 - 17,544,400 (-)Ensembl
RefSeq Acc Id: ENST00000527551
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,494,162 - 17,496,913 (-)Ensembl
RefSeq Acc Id: ENST00000527720   ⟹   ENSP00000432944
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,897 - 17,533,510 (-)Ensembl
RefSeq Acc Id: ENST00000529563
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,965 - 17,516,622 (-)Ensembl
RefSeq Acc Id: ENST00000530700
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,514,441 - 17,520,962 (-)Ensembl
RefSeq Acc Id: ENST00000534556
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,501,072 - 17,502,049 (-)Ensembl
RefSeq Acc Id: ENST00000624811
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1117,493,900 - 17,495,093 (-)Ensembl
RefSeq Acc Id: NM_001297764   ⟹   NP_001284693
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,493,900 - 17,544,416 (-)NCBI
CHM1_11117,515,265 - 17,565,784 (-)NCBI
T2T-CHM13v2.01117,591,495 - 17,642,149 (-)NCBI
Sequence:
RefSeq Acc Id: NM_005709   ⟹   NP_005700
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,493,900 - 17,544,416 (-)NCBI
GRCh371117,515,442 - 17,565,963 (-)ENTREZGENE
GRCh371117,515,442 - 17,565,963 (-)NCBI
Build 361117,472,018 - 17,522,539 (-)NCBI Archive
HuRef1117,199,243 - 17,249,828 (-)ENTREZGENE
CHM1_11117,515,265 - 17,565,784 (-)NCBI
T2T-CHM13v2.01117,591,495 - 17,642,149 (-)NCBI
Sequence:
RefSeq Acc Id: NM_153676   ⟹   NP_710142
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,493,900 - 17,544,416 (-)NCBI
GRCh371117,515,442 - 17,565,963 (-)ENTREZGENE
GRCh371117,515,442 - 17,565,963 (-)NCBI
Build 361117,472,018 - 17,522,539 (-)NCBI Archive
HuRef1117,199,243 - 17,249,828 (-)ENTREZGENE
CHM1_11117,515,265 - 17,565,784 (-)NCBI
T2T-CHM13v2.01117,591,495 - 17,642,149 (-)NCBI
Sequence:
RefSeq Acc Id: NR_123738
RefSeq Status: REVIEWED
Type: NON-CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,493,900 - 17,544,416 (-)NCBI
CHM1_11117,515,265 - 17,565,784 (-)NCBI
T2T-CHM13v2.01117,591,495 - 17,642,149 (-)NCBI
Sequence:
RefSeq Acc Id: XM_011519832   ⟹   XP_011518134
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,493,900 - 17,544,416 (-)NCBI
Sequence:
RefSeq Acc Id: XM_011519834   ⟹   XP_011518136
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,514,466 - 17,544,416 (-)NCBI
Sequence:
RefSeq Acc Id: XM_017017072   ⟹   XP_016872561
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,504,647 - 17,544,416 (-)NCBI
Sequence:
RefSeq Acc Id: XM_017017073   ⟹   XP_016872562
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,504,647 - 17,544,416 (-)NCBI
Sequence:
RefSeq Acc Id: XM_017017074   ⟹   XP_016872563
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,504,647 - 17,544,416 (-)NCBI
Sequence:
RefSeq Acc Id: XM_017017075   ⟹   XP_016872564
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,494,413 - 17,544,416 (-)NCBI
Sequence:
RefSeq Acc Id: XM_047426219   ⟹   XP_047282175
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,501,051 - 17,544,416 (-)NCBI
RefSeq Acc Id: XM_047426220   ⟹   XP_047282176
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,511,951 - 17,544,416 (-)NCBI
RefSeq Acc Id: XM_047426221   ⟹   XP_047282177
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,501,051 - 17,544,416 (-)NCBI
RefSeq Acc Id: XM_047426222   ⟹   XP_047282178
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,511,911 - 17,544,416 (-)NCBI
Protein Sequences
Protein RefSeqs NP_001284693 (Get FASTA)   NCBI Sequence Viewer  
  NP_005700 (Get FASTA)   NCBI Sequence Viewer  
  NP_710142 (Get FASTA)   NCBI Sequence Viewer  
  XP_011518134 (Get FASTA)   NCBI Sequence Viewer  
  XP_011518136 (Get FASTA)   NCBI Sequence Viewer  
  XP_016872561 (Get FASTA)   NCBI Sequence Viewer  
  XP_016872562 (Get FASTA)   NCBI Sequence Viewer  
  XP_016872563 (Get FASTA)   NCBI Sequence Viewer  
  XP_016872564 (Get FASTA)   NCBI Sequence Viewer  
  XP_047282175 (Get FASTA)   NCBI Sequence Viewer  
  XP_047282176 (Get FASTA)   NCBI Sequence Viewer  
  XP_047282177 (Get FASTA)   NCBI Sequence Viewer  
  XP_047282178 (Get FASTA)   NCBI Sequence Viewer  
GenBank Protein AAC18048 (Get FASTA)   NCBI Sequence Viewer  
  AAC18049 (Get FASTA)   NCBI Sequence Viewer  
  AAH16057 (Get FASTA)   NCBI Sequence Viewer  
  ALQ33956 (Get FASTA)   NCBI Sequence Viewer  
  ALQ33957 (Get FASTA)   NCBI Sequence Viewer  
  BAA81739 (Get FASTA)   NCBI Sequence Viewer  
  BAA81740 (Get FASTA)   NCBI Sequence Viewer  
  BAB15040 (Get FASTA)   NCBI Sequence Viewer  
  BAF83477 (Get FASTA)   NCBI Sequence Viewer  
  BAG62565 (Get FASTA)   NCBI Sequence Viewer  
  DAA00086 (Get FASTA)   NCBI Sequence Viewer  
  EAW68431 (Get FASTA)   NCBI Sequence Viewer  
  EAW68432 (Get FASTA)   NCBI Sequence Viewer  
  EAW68433 (Get FASTA)   NCBI Sequence Viewer  
  EAW68434 (Get FASTA)   NCBI Sequence Viewer  
  Q9Y6N9 (Get FASTA)   NCBI Sequence Viewer  
  UEP53570 (Get FASTA)   NCBI Sequence Viewer  
Reference Sequences
RefSeq Acc Id: NP_710142   ⟸   NM_153676
- Peptide Label: isoform b3
- UniProtKB: Q9Y6N9 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_005700   ⟸   NM_005709
- Peptide Label: isoform a
- UniProtKB: Q9Y6N9 (UniProtKB/Swiss-Prot),   A0A0S2Z4U9 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001284693   ⟸   NM_001297764
- Peptide Label: isoform c
- UniProtKB: Q9Y6N9 (UniProtKB/Swiss-Prot),   A0A0S2Z4V1 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: XP_011518134   ⟸   XM_011519832
- Peptide Label: isoform X3
- Sequence:
RefSeq Acc Id: XP_011518136   ⟸   XM_011519834
- Peptide Label: isoform X6
- Sequence:
RefSeq Acc Id: XP_016872564   ⟸   XM_017017075
- Peptide Label: isoform X10
- Sequence:
RefSeq Acc Id: XP_016872562   ⟸   XM_017017073
- Peptide Label: isoform X2
- Sequence:
RefSeq Acc Id: XP_016872563   ⟸   XM_017017074
- Peptide Label: isoform X4
- Sequence:
RefSeq Acc Id: XP_016872561   ⟸   XM_017017072
- Peptide Label: isoform X1
- Sequence:
RefSeq Acc Id: ENSP00000005226   ⟸   ENST00000005226
RefSeq Acc Id: ENSP00000437128   ⟸   ENST00000526181
RefSeq Acc Id: ENSP00000432236   ⟸   ENST00000526313
RefSeq Acc Id: ENSP00000436934   ⟸   ENST00000527020
RefSeq Acc Id: ENSP00000432944   ⟸   ENST00000527720
RefSeq Acc Id: ENSP00000317018   ⟸   ENST00000318024
RefSeq Acc Id: XP_047282177   ⟸   XM_047426221
- Peptide Label: isoform X8
RefSeq Acc Id: XP_047282175   ⟸   XM_047426219
- Peptide Label: isoform X5
RefSeq Acc Id: XP_047282178   ⟸   XM_047426222
- Peptide Label: isoform X9
RefSeq Acc Id: XP_047282176   ⟸   XM_047426220
- Peptide Label: isoform X7
Protein Domains
PDZ

Protein Structures
Name Modeler Protein Id AA Range Protein Structure
AF-Q9Y6N9-F1-model_v2 AlphaFold Q9Y6N9 1-552 view protein structure

Promoters
RGD ID:6788440
Promoter ID:HG_KWN:12429
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:HeLa_S3
Transcripts:ENST00000005226,   ENST00000344020,   ENST00000396297,   UC001MNF.1,   UC001MNG.1,   UC009YHB.1
Position:
Human AssemblyChrPosition (strand)Source
Build 361117,522,176 - 17,522,676 (-)MPROMDB
RGD ID:7219763
Promoter ID:EPDNEW_H15628
Type:initiation region
Name:USH1C_1
Description:USH1 protein network component harmonin
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh381117,544,416 - 17,544,476EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_153676.4(USH1C):c.308G>A (p.Arg103His) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000662094]|Usher syndrome type 1 [RCV000662095]|Usher syndrome type 1C [RCV000032622]|Usher syndrome type 1C [RCV000675046]|not provided [RCV001377937] Chr11:17531233 [GRCh38]
Chr11:17552780 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic|uncertain significance
NM_153676.4(USH1C):c.2227-1G>A single nucleotide variant Usher syndrome type 1C [RCV000032623] Chr11:17501536 [GRCh38]
Chr11:17523083 [GRCh37]
Chr11:11p15.1
pathogenic
USH1C, 1-BP DEL, 1220G deletion Usher syndrome type 1C [RCV000032624] Chr11:11p15.1 pathogenic
NM_153676.4(USH1C):c.497-2del deletion Usher syndrome type 1 [RCV001003246]|Usher syndrome type 1C [RCV000005447]|not provided [RCV001383896] Chr11:17527042 [GRCh38]
Chr11:17548589 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.238dup (p.Arg80fs) duplication Autosomal recessive nonsyndromic hearing loss 18A [RCV000984011]|Hearing loss, autosomal recessive [RCV001291493]|Rare genetic deafness [RCV000824775]|Retinal dystrophy [RCV001073457]|Retinitis pigmentosa [RCV000787893]|Usher syndrome [RCV000505081]|Usher syndrome type 1 [RCV000213574]|Usher syndrome type 1C [RCV000005448]|not provided [RCV000727619] Chr11:17531408..17531409 [GRCh38]
Chr11:17552955..17552956 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] microsatellite Usher syndrome type 1 [RCV000218261]|Usher syndrome type 1C [RCV000005449] Chr11:17527112..17527113 [GRCh38]
Chr11:17548737 [GRCh37]
Chr11:11p15.1
benign|conflicting interpretations of pathogenicity|conflicting data from submitters
NM_153676.4(USH1C):c.216G>A (p.Val72=) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000984012]|Rare genetic deafness [RCV000824776]|Usher syndrome [RCV000504855]|Usher syndrome type 1 [RCV000220605]|Usher syndrome type 1C [RCV000005450]|Usher syndrome type 1C [RCV000763237]|not provided [RCV000724016] Chr11:17531431 [GRCh38]
Chr11:17552978 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.36+1G>T single nucleotide variant Usher syndrome type 1C [RCV000005451] Chr11:17544271 [GRCh38]
Chr11:17565818 [GRCh37]
Chr11:11p15.1
pathogenic
USH1C, IVS5DS, G-A, +1 single nucleotide variant Usher syndrome, type 1C [RCV000005452] Chr11:11p15.1 pathogenic
NM_153676.4(USH1C):c.91C>T (p.Arg31Ter) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000983994]|Usher syndrome type 1C [RCV000005453]|Usher syndrome type 1C [RCV000763238]|not provided [RCV000595941] Chr11:17533268 [GRCh38]
Chr11:17554815 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.1019+5G>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000005454] Chr11:17522779 [GRCh38]
Chr11:17544326 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.1823C>G (p.Pro608Arg) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000005455]|Meniere disease [RCV001797045]|Usher syndrome type 1C [RCV001276292]|not provided [RCV000755427]|not specified [RCV000041259] Chr11:17509546 [GRCh38]
Chr11:17531093 [GRCh37]
Chr11:11p15.1
pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) single nucleotide variant Usher syndrome type 1C [RCV000005456]|not provided [RCV000972120]|not specified [RCV000041291] Chr11:17527331 [GRCh38]
Chr11:17548878 [GRCh37]
Chr11:11p15.1
pathogenic|benign|uncertain significance
NM_153676.4(USH1C):c.966G>C (p.Arg322=) single nucleotide variant not provided [RCV000728053] Chr11:17522837 [GRCh38]
Chr11:17544384 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.1211-1152G>A single nucleotide variant Usher syndrome type 1C [RCV000337284]|not provided [RCV001518731]|not specified [RCV000038629] Chr11:17517442 [GRCh38]
Chr11:17538989 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.1211-1134G>A single nucleotide variant Usher syndrome type 1C [RCV000376452]|not provided [RCV000993529]|not specified [RCV000038630] Chr11:17517424 [GRCh38]
Chr11:17538971 [GRCh37]
Chr11:11p15.1
benign|uncertain significance
NM_153676.4(USH1C):c.1211-1129G>A single nucleotide variant Usher syndrome type 1C [RCV000285425]|not provided [RCV000959903]|not specified [RCV000038631] Chr11:17517419 [GRCh38]
Chr11:17538966 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.101A>G (p.His34Arg) single nucleotide variant Usher syndrome type 1C [RCV001108637]|not provided [RCV000959167]|not specified [RCV000041246] Chr11:17533258 [GRCh38]
Chr11:17554805 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity
NM_153676.4(USH1C):c.105-16C>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV002243686]|Usher syndrome type 1C [RCV002243685]|not provided [RCV001513061]|not specified [RCV000041247] Chr11:17531558 [GRCh38]
Chr11:17553105 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1085+21C>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538059]|Usher syndrome type 1C [RCV001538058]|not provided [RCV001711129]|not specified [RCV000041248] Chr11:17521325 [GRCh38]
Chr11:17542872 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1086-12G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538051]|Usher syndrome type 1C [RCV000311473]|not provided [RCV001519502]|not specified [RCV000041249] Chr11:17521006 [GRCh38]
Chr11:17542553 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.1136G>A (p.Gly379Asp) single nucleotide variant Usher syndrome type 1C [RCV001273249]|not provided [RCV001244821]|not specified [RCV000041250] Chr11:17520944 [GRCh38]
Chr11:17542491 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1188A>G (p.Pro396=) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538050]|Usher syndrome type 1C [RCV000395027]|not provided [RCV001512209]|not specified [RCV000041251] Chr11:17520892 [GRCh38]
Chr11:17542439 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.127G>A (p.Val43Met) single nucleotide variant Usher syndrome type 1C [RCV001271302]|not provided [RCV001570924]|not specified [RCV000041252] Chr11:17531520 [GRCh38]
Chr11:17553067 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1731G>A (p.Pro577=) single nucleotide variant not specified [RCV000041253] Chr11:17509638 [GRCh38]
Chr11:17531185 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1430G>A (p.Arg477Gln) single nucleotide variant Hearing impairment [RCV001375297]|not provided [RCV000756869]|not specified [RCV000041254] Chr11:17510505 [GRCh38]
Chr11:17532052 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.1531-11A>G single nucleotide variant Usher syndrome type 1C [RCV000665853]|not specified [RCV000041255] Chr11:17509849 [GRCh38]
Chr11:17531396 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1740T>C (p.Pro580=) single nucleotide variant not provided [RCV000829273]|not specified [RCV000041256] Chr11:17509629 [GRCh38]
Chr11:17531176 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.1770C>T (p.Ala590=) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538020]|Usher syndrome type 1C [RCV001538019]|not provided [RCV001512363]|not specified [RCV000041257] Chr11:17509599 [GRCh38]
Chr11:17531146 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1792C>T (p.Arg598Cys) single nucleotide variant not specified [RCV000041258] Chr11:17509577 [GRCh38]
Chr11:17531124 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1872G>A (p.Ser624=) single nucleotide variant not provided [RCV000969060]|not specified [RCV000041260] Chr11:17509497 [GRCh38]
Chr11:17531044 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1889T>C (p.Leu630Pro) single nucleotide variant not specified [RCV000041261] Chr11:17509480 [GRCh38]
Chr11:17531027 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1906C>T (p.Arg636Cys) single nucleotide variant not provided [RCV000725958]|not specified [RCV000041262] Chr11:17509463 [GRCh38]
Chr11:17531010 [GRCh37]
Chr11:11p15.1
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.2013+5T>C single nucleotide variant not provided [RCV000929932]|not specified [RCV000041263] Chr11:17509351 [GRCh38]
Chr11:17530898 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2047C>T (p.Pro683Ser) single nucleotide variant not specified [RCV000041264] Chr11:17505916 [GRCh38]
Chr11:17527463 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2134-12T>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538018]|Usher syndrome type 1C [RCV001538017]|not specified [RCV000041265] Chr11:17504709 [GRCh38]
Chr11:17526256 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000041266]|Usher syndrome type 1 [RCV001004552]|Usher syndrome type 1C [RCV000984230]|not provided [RCV000725879]|not specified [RCV000211746] Chr11:17504664 [GRCh38]
Chr11:17526211 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.2184+12C>T single nucleotide variant not provided [RCV001549713]|not specified [RCV000041268] Chr11:17504635 [GRCh38]
Chr11:17526182 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2191C>T (p.Arg731Trp) single nucleotide variant Hearing impairment [RCV001375307]|Usher syndrome type 1C [RCV000669240]|Usher syndrome type 1C [RCV001272254]|not provided [RCV001361788]|not specified [RCV000041269] Chr11:17501974 [GRCh38]
Chr11:17523521 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2194A>G (p.Lys732Glu) single nucleotide variant Usher syndrome type 1C [RCV000666460]|Usher syndrome type 1C [RCV001826585]|not specified [RCV000041270] Chr11:17501971 [GRCh38]
Chr11:17523518 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2226+12C>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538016]|Usher syndrome type 1C [RCV000325137]|not provided [RCV001513419]|not specified [RCV000041271] Chr11:17501927 [GRCh38]
Chr11:17523474 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.225T>C (p.Asp75=) single nucleotide variant Usher syndrome type 1C [RCV000402888]|not provided [RCV000950759]|not specified [RCV000041272] Chr11:17531422 [GRCh38]
Chr11:17552969 [GRCh37]
Chr11:11p15.1
benign|uncertain significance
NM_153676.4(USH1C):c.2340C>T (p.Val780=) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538013]|Usher syndrome type 1C [RCV000276982]|not provided [RCV001514590]|not specified [RCV000041273] Chr11:17501091 [GRCh38]
Chr11:17522638 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2341G>A (p.Val781Ile) single nucleotide variant Usher syndrome type 1C [RCV000668855]|Usher syndrome type 1C [RCV001272250]|not provided [RCV001852838]|not specified [RCV000041274] Chr11:17501090 [GRCh38]
Chr11:17522637 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2347G>T (p.Ala783Ser) single nucleotide variant not provided [RCV000969059]|not specified [RCV000041275] Chr11:17501084 [GRCh38]
Chr11:17522631 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2418C>T (p.Asn806=) single nucleotide variant Usher syndrome type 1C [RCV000667965]|not provided [RCV001452232]|not specified [RCV000041277] Chr11:17498234 [GRCh38]
Chr11:17519781 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2441C>A (p.Thr814Asn) single nucleotide variant Usher syndrome type 1C [RCV000397022]|Usher syndrome type 1C [RCV000669750]|not specified [RCV000041278] Chr11:17498211 [GRCh38]
Chr11:17519758 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2457G>C (p.Glu819Asp) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537986]|Usher syndrome type 1C [RCV000988495]|not provided [RCV001512208]|not specified [RCV000041279] Chr11:17498195 [GRCh38]
Chr11:17519742 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2458G>A (p.Ala820Thr) single nucleotide variant Usher syndrome type 1C [RCV000669772]|not provided [RCV001852839]|not specified [RCV000041280] Chr11:17498194 [GRCh38]
Chr11:17519741 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2488G>A (p.Gly830Arg) single nucleotide variant not provided [RCV000969058]|not specified [RCV000041281] Chr11:17498164 [GRCh38]
Chr11:17519711 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2490+12G>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537985]|Usher syndrome type 1C [RCV000287356]|not provided [RCV001513064]|not specified [RCV000041282] Chr11:17498150 [GRCh38]
Chr11:17519697 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2499C>T (p.Ile833=) single nucleotide variant Usher syndrome type 1C [RCV000406651]|not provided [RCV000903610]|not specified [RCV000041283] Chr11:17496805 [GRCh38]
Chr11:17518352 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.2547-11T>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537982]|Usher syndrome type 1C [RCV001537981]|not provided [RCV001642569]|not specified [RCV000041284] Chr11:17495688 [GRCh38]
Chr11:17517235 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2611G>A (p.Ala871Thr) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001331815]|Usher syndrome type 1C [RCV000670907]|Usher syndrome type 1C [RCV001810410]|not provided [RCV001471034]|not specified [RCV000041285] Chr11:17495613 [GRCh38]
Chr11:17517160 [GRCh37]
Chr11:11p15.1
benign|likely benign|uncertain significance
NM_153676.4(USH1C):c.2617G>A (p.Val873Met) single nucleotide variant Usher syndrome type 1C [RCV000665997]|not provided [RCV000943587]|not specified [RCV000041286] Chr11:17495607 [GRCh38]
Chr11:17517154 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.264G>A (p.Val88=) single nucleotide variant not provided [RCV001488734]|not specified [RCV000041287] Chr11:17531277 [GRCh38]
Chr11:17552824 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.294C>T (p.Leu98=) single nucleotide variant Usher syndrome type 1C [RCV001106428]|not provided [RCV000888945]|not specified [RCV000041288] Chr11:17531247 [GRCh38]
Chr11:17552794 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.307C>T (p.Arg103Cys) single nucleotide variant not provided [RCV000756870]|not specified [RCV000041289] Chr11:17531234 [GRCh38]
Chr11:17552781 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.381G>T (p.Gly127=) single nucleotide variant Usher syndrome type 1C [RCV001106427]|not provided [RCV000958386]|not specified [RCV000041290] Chr11:17531160 [GRCh38]
Chr11:17552707 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001578830]|Usher syndrome type 1C [RCV000343731]|not provided [RCV000963575]|not specified [RCV000041292] Chr11:17527316 [GRCh38]
Chr11:17548863 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.496+13A>G single nucleotide variant not provided [RCV001488934]|not specified [RCV000041293] Chr11:17527210 [GRCh38]
Chr11:17548757 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.496+21G>T single nucleotide variant not specified [RCV000041294] Chr11:17527202 [GRCh38]
Chr11:17548749 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.497-4G>A single nucleotide variant Usher syndrome type 1C [RCV000670885]|Usher syndrome type 1C [RCV001276296]|not provided [RCV000892081]|not specified [RCV000041295] Chr11:17527044 [GRCh38]
Chr11:17548591 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.582C>T (p.Gly194=) single nucleotide variant Usher syndrome type 1C [RCV000665373]|not specified [RCV000041296] Chr11:17526439 [GRCh38]
Chr11:17547986 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.587G>A (p.Arg196Gln) single nucleotide variant not provided [RCV001038980]|not specified [RCV000041297] Chr11:17526434 [GRCh38]
Chr11:17547981 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.651A>G (p.Val217=) single nucleotide variant Usher syndrome type 1C [RCV000303751]|not provided [RCV000959904]|not specified [RCV000041298] Chr11:17526370 [GRCh38]
Chr11:17547917 [GRCh37]
Chr11:11p15.1
benign|uncertain significance
NM_153676.4(USH1C):c.592A>T (p.Ser198Cys) single nucleotide variant Usher syndrome type 1C [RCV001831696]|not specified [RCV000041299] Chr11:17526429 [GRCh38]
Chr11:17547976 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.648G>A (p.Leu216=) single nucleotide variant Usher syndrome type 1C [RCV000263897]|not provided [RCV000960926]|not specified [RCV000041300] Chr11:17526373 [GRCh38]
Chr11:17547920 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.760-4C>T single nucleotide variant not provided [RCV000881764]|not specified [RCV000041301] Chr11:17523482 [GRCh38]
Chr11:17545029 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.819+10G>C single nucleotide variant Usher syndrome type 1C [RCV000350335]|not provided [RCV001518344]|not specified [RCV000041302] Chr11:17523409 [GRCh38]
Chr11:17544956 [GRCh37]
Chr11:11p15.1
benign|likely benign|uncertain significance
NM_153676.4(USH1C):c.908G>A (p.Arg303Gln) single nucleotide variant Usher syndrome type 1C [RCV001831697]|not specified [RCV000041303] Chr11:17522895 [GRCh38]
Chr11:17544442 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh38/hg38 11p15.5-13(chr11:202758-31726224)x3 copy number gain See cases [RCV000053613] Chr11:202758..31726224 [GRCh38]
Chr11:202758..31747772 [GRCh37]
Chr11:192758..31704348 [NCBI36]
Chr11:11p15.5-13
pathogenic
NM_153676.3(USH1C):c.1976C>T (p.Ser659Phe) single nucleotide variant Malignant melanoma [RCV000069276] Chr11:17509393 [GRCh38]
Chr11:17530940 [GRCh37]
Chr11:17487516 [NCBI36]
Chr11:11p15.1
not provided
NM_005709.3(USH1C):c.1195C>T (p.Leu399Phe) single nucleotide variant Malignant melanoma [RCV000069277] Chr11:17520885 [GRCh38]
Chr11:17542432 [GRCh37]
Chr11:17499008 [NCBI36]
Chr11:11p15.1
not provided
NM_153676.4(USH1C):c.76C>T (p.Leu26Phe) single nucleotide variant Usher syndrome type 1C [RCV000673769]|Usher syndrome type 1C [RCV001835672]|not provided [RCV001364252] Chr11:17533283 [GRCh38]
Chr11:17554830 [GRCh37]
Chr11:17511406 [NCBI36]
Chr11:11p15.1
uncertain significance|not provided
NM_153676.4(USH1C):c.569C>T (p.Ser190Leu) single nucleotide variant Usher syndrome type 1C [RCV000671159]|Usher syndrome type 1C [RCV001831813]|not provided [RCV000122525] Chr11:17526763 [GRCh38]
Chr11:17548310 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.387+17C>T single nucleotide variant not provided [RCV001509644]|not specified [RCV000126227] Chr11:17531137 [GRCh38]
Chr11:17552684 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.239G>A (p.Arg80Gln) single nucleotide variant Usher syndrome type 1C [RCV001835453]|not provided [RCV001302460] Chr11:17531408 [GRCh38]
Chr11:17552955 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2485G>A (p.Gly829Ser) single nucleotide variant not provided [RCV001303610] Chr11:17498167 [GRCh38]
Chr11:17519714 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1069C>T (p.Arg357Trp) single nucleotide variant Usher syndrome type 1C [RCV000665382]|Usher syndrome type 1C [RCV001831997]|not provided [RCV000174556] Chr11:17521362 [GRCh38]
Chr11:17542909 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh38/hg38 11p15.5-15.1(chr11:446754-18904742)x3 copy number gain See cases [RCV000133997] Chr11:446754..18904742 [GRCh38]
Chr11:446754..18926289 [GRCh37]
Chr11:436754..18882865 [NCBI36]
Chr11:11p15.5-15.1
pathogenic
NM_153676.4(USH1C):c.1211-1107C>T single nucleotide variant Usher syndrome type 1C [RCV001826843]|not specified [RCV000155933] Chr11:17517397 [GRCh38]
Chr11:17538944 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.965G>A (p.Arg322Gln) single nucleotide variant Usher syndrome type 1C [RCV001273251]|not provided [RCV001238936]|not specified [RCV000152555] Chr11:17522838 [GRCh38]
Chr11:17544385 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.629A>C (p.Lys210Thr) single nucleotide variant Usher syndrome type 1C [RCV000674723]|Usher syndrome type 1C [RCV001826812]|not provided [RCV001238924]|not specified [RCV000152556] Chr11:17526392 [GRCh38]
Chr11:17547939 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1574T>C (p.Leu525Pro) single nucleotide variant not specified [RCV000156108] Chr11:17509795 [GRCh38]
Chr11:17531342 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2311G>A (p.Gly771Ser) single nucleotide variant Usher syndrome type 1C [RCV001831977]|not specified [RCV000156523] Chr11:17501120 [GRCh38]
Chr11:17522667 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2112A>G (p.Pro704=) single nucleotide variant not provided [RCV000886181]|not specified [RCV000156644] Chr11:17505851 [GRCh38]
Chr11:17527398 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1874C>T (p.Ala625Val) single nucleotide variant Usher syndrome type 1C [RCV000666926]|not specified [RCV000156677] Chr11:17509495 [GRCh38]
Chr11:17531042 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1822C>T (p.Pro608Ser) single nucleotide variant Usher syndrome type 1C [RCV000666097]|Usher syndrome type 1C [RCV001276293]|not specified [RCV000156767] Chr11:17509547 [GRCh38]
Chr11:17531094 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2591G>A (p.Arg864Gln) single nucleotide variant not provided [RCV000913381]|not specified [RCV000156889] Chr11:17495633 [GRCh38]
Chr11:17517180 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2547-8A>G single nucleotide variant not provided [RCV000828929]|not specified [RCV000155308] Chr11:17495685 [GRCh38]
Chr11:17517232 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2240A>G (p.Gln747Arg) single nucleotide variant Usher syndrome type 1C [RCV000668570]|Usher syndrome type 1C [RCV001272252]|not specified [RCV000155312] Chr11:17501522 [GRCh38]
Chr11:17523069 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2184+10T>C single nucleotide variant not provided [RCV000943311]|not specified [RCV000155313] Chr11:17504637 [GRCh38]
Chr11:17526184 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2014-1G>A single nucleotide variant Usher syndrome type 1 [RCV001004553]|not provided [RCV000725400]|not specified [RCV000155314] Chr11:17505950 [GRCh38]
Chr11:17527497 [GRCh37]
Chr11:11p15.1
pathogenic|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.1801C>A (p.Pro601Thr) single nucleotide variant not provided [RCV000915897]|not specified [RCV000152546] Chr11:17509568 [GRCh38]
Chr11:17531115 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1678G>C (p.Ala560Pro) single nucleotide variant not provided [RCV000920509]|not specified [RCV000152548] Chr11:17509691 [GRCh38]
Chr11:17531238 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1576G>A (p.Ala526Thr) single nucleotide variant not specified [RCV000152550] Chr11:17509793 [GRCh38]
Chr11:17531340 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1234G>A (p.Asp412Asn) single nucleotide variant not provided [RCV001411432]|not specified [RCV000152551] Chr11:17516267 [GRCh38]
Chr11:17537814 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1233C>T (p.Tyr411=) single nucleotide variant Usher syndrome type 1C [RCV000668545]|not specified [RCV000152552] Chr11:17516268 [GRCh38]
Chr11:17537815 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1211-1188G>A single nucleotide variant not provided [RCV001392833]|not specified [RCV000152553] Chr11:17517478 [GRCh38]
Chr11:17539025 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.186T>C (p.Ile62=) single nucleotide variant Usher syndrome type 1C [RCV001106431]|not provided [RCV000842340]|not specified [RCV000152557] Chr11:17531461 [GRCh38]
Chr11:17553008 [GRCh37]
Chr11:11p15.1
benign|likely benign|uncertain significance
NM_153676.4(USH1C):c.674+4G>A single nucleotide variant Usher syndrome type 1C [RCV001103386]|not provided [RCV000726548]|not specified [RCV000155397] Chr11:17526343 [GRCh38]
Chr11:17547890 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.1859G>T (p.Arg620Leu) single nucleotide variant not provided [RCV000892650]|not specified [RCV000152545] Chr11:17509510 [GRCh38]
Chr11:17531057 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1632C>T (p.Asp544=) single nucleotide variant not provided [RCV000969061]|not specified [RCV000152547] Chr11:17509737 [GRCh38]
Chr11:17531284 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.1597G>A (p.Ala533Thr) single nucleotide variant not provided [RCV000939264]|not specified [RCV000152549] Chr11:17509772 [GRCh38]
Chr11:17531319 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.1086-13G>T single nucleotide variant Usher syndrome type 1C [RCV000271322]|not provided [RCV001509793]|not specified [RCV000152554] Chr11:17521007 [GRCh38]
Chr11:17542554 [GRCh37]
Chr11:11p15.1
benign|likely benign|uncertain significance
NM_153676.4(USH1C):c.2655+12G>A single nucleotide variant Usher syndrome type 1C [RCV000666930]|not specified [RCV000155714] Chr11:17495557 [GRCh38]
Chr11:17517104 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2391G>A (p.Val797=) single nucleotide variant not provided [RCV000175450] Chr11:17498261 [GRCh38]
Chr11:17519808 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.2538C>T (p.Asp846=) single nucleotide variant not provided [RCV000902274]|not specified [RCV000155309] Chr11:17496766 [GRCh38]
Chr11:17518313 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2419G>A (p.Gly807Ser) single nucleotide variant Usher syndrome type 1C [RCV000791090]|not provided [RCV001545234]|not specified [RCV000155310] Chr11:17498233 [GRCh38]
Chr11:17519780 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2410G>A (p.Ala804Thr) single nucleotide variant Usher syndrome type 1C [RCV001103299]|not provided [RCV000425626]|not specified [RCV000155311] Chr11:17498242 [GRCh38]
Chr11:17519789 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.684C>T (p.Ser228=) single nucleotide variant Usher syndrome type 1C [RCV001103385]|not provided [RCV000839977]|not specified [RCV000155315] Chr11:17524526 [GRCh38]
Chr11:17546073 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.946G>C (p.Glu316Gln) single nucleotide variant Usher syndrome type 1C [RCV001106340]|not provided [RCV000889692]|not specified [RCV000155398] Chr11:17522857 [GRCh38]
Chr11:17544404 [GRCh37]
Chr11:11p15.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.114C>T (p.Asp38=) single nucleotide variant Usher syndrome type 1C [RCV000340350]|not provided [RCV000891086]|not specified [RCV000155399] Chr11:17531533 [GRCh38]
Chr11:17553080 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.513C>T (p.Pro171=) single nucleotide variant Usher syndrome type 1C [RCV001276295]|not provided [RCV000179454] Chr11:17527024 [GRCh38]
Chr11:17548571 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.188G>A (p.Arg63Gln) single nucleotide variant Usher syndrome type 1C [RCV000666825]|Usher syndrome type 1C [RCV001832015]|not provided [RCV000177238] Chr11:17531459 [GRCh38]
Chr11:17553006 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.379G>A (p.Gly127Arg) single nucleotide variant Usher syndrome type 1C [RCV000672839]|Usher syndrome type 1C [RCV001828088]|not provided [RCV001241209]|not specified [RCV000223498] Chr11:17531162 [GRCh38]
Chr11:17552709 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.241C>T (p.Arg81Cys) single nucleotide variant Usher syndrome type 1C [RCV000669850]|Usher syndrome type 1C [RCV001276299]|not specified [RCV000223556] Chr11:17531406 [GRCh38]
Chr11:17552953 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1476G>T (p.Arg492Ser) single nucleotide variant not specified [RCV000219683] Chr11:17510459 [GRCh38]
Chr11:17532006 [GRCh37]
Chr11:11p15.1
uncertain significance
NP_005700.2(USH1C):p.Arg357Trp protein only Usher syndrome type 1 [RCV000217242] Chr11:11p15.1 likely pathogenic
NM_153676.4(USH1C):c.248+7_248+20del deletion not provided [RCV001059559]|not specified [RCV000220457] Chr11:17531379..17531392 [GRCh38]
Chr11:17552926..17552939 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1956_1957del (p.His652fs) microsatellite Usher syndrome type 1C [RCV000669891] Chr11:17509412..17509413 [GRCh38]
Chr11:17530959..17530960 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2185-2A>G single nucleotide variant Usher syndrome type 1C [RCV000669950] Chr11:17501982 [GRCh38]
Chr11:17523529 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.245C>G (p.Ser82Cys) single nucleotide variant Usher syndrome type 1C [RCV000671029]|Usher syndrome type 1C [RCV001833216]|not specified [RCV000215948] Chr11:17531402 [GRCh38]
Chr11:17552949 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1548G>A (p.Pro516=) single nucleotide variant Usher syndrome type 1C [RCV000670018]|not specified [RCV000222384] Chr11:17509821 [GRCh38]
Chr11:17531368 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.7C>A (p.Arg3=) single nucleotide variant not provided [RCV001485503]|not specified [RCV000222607] Chr11:17544301 [GRCh38]
Chr11:17565848 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1449G>A (p.Ser483=) single nucleotide variant not provided [RCV000979845]|not specified [RCV000218756] Chr11:17510486 [GRCh38]
Chr11:17532033 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2579C>T (p.Pro860Leu) single nucleotide variant not specified [RCV000218913] Chr11:17495645 [GRCh38]
Chr11:17517192 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.152A>G (p.Asn51Ser) single nucleotide variant Usher syndrome type 1C [RCV001828086]|not provided [RCV001589139]|not specified [RCV000221329] Chr11:17531495 [GRCh38]
Chr11:17553042 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1013A>C (p.Glu338Ala) single nucleotide variant Usher syndrome type 1C [RCV000669873]|Usher syndrome type 1C [RCV001833215]|not provided [RCV001853494]|not specified [RCV000221394] Chr11:17522790 [GRCh38]
Chr11:17544337 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2280+2T>C single nucleotide variant Usher syndrome type 1C [RCV000669682] Chr11:17501480 [GRCh38]
Chr11:17523027 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1A>G (p.Met1Val) single nucleotide variant Usher syndrome type 1C [RCV000669702] Chr11:17544307 [GRCh38]
Chr11:17565854 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.2192G>A (p.Arg731Gln) single nucleotide variant Usher syndrome type 1C [RCV000664528]|Usher syndrome type 1C [RCV001272253]|not provided [RCV001248288]|not specified [RCV000215016] Chr11:17501973 [GRCh38]
Chr11:17523520 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2302C>A (p.Leu768Met) single nucleotide variant not specified [RCV000215071] Chr11:17501129 [GRCh38]
Chr11:17522676 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) single nucleotide variant Usher syndrome type 1C [RCV000665700]|not provided [RCV000725257]|not specified [RCV000216768] Chr11:17505839 [GRCh38]
Chr11:17527386 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.2418C>A (p.Asn806Lys) single nucleotide variant Usher syndrome type 1C [RCV000670409]|Usher syndrome type 1C [RCV001828087]|not provided [RCV001360961]|not specified [RCV000219294] Chr11:17498234 [GRCh38]
Chr11:17519781 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1413+13C>T single nucleotide variant not specified [RCV000215236] Chr11:17511889 [GRCh38]
Chr11:17533436 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.921G>A (p.Ala307=) single nucleotide variant Usher syndrome type 1C [RCV000362464]|not provided [RCV000921188]|not specified [RCV000217016] Chr11:17522882 [GRCh38]
Chr11:17544429 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1210+5G>A single nucleotide variant Retinal dystrophy [RCV000225472]|Usher syndrome type 1C [RCV000664522] Chr11:17520865 [GRCh38]
Chr11:17542412 [GRCh37]
Chr11:11p15.1
likely pathogenic|uncertain significance
NM_153676.4(USH1C):c.2695C>G (p.Arg899Gly) single nucleotide variant not provided [RCV000756871] Chr11:17494337 [GRCh38]
Chr11:17515884 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2590C>T (p.Arg864Ter) single nucleotide variant Usher syndrome type 1C [RCV000664922]|not provided [RCV000520104] Chr11:17495634 [GRCh38]
Chr11:17517181 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.311G>A (p.Gly104Asp) single nucleotide variant Usher syndrome type 1 [RCV001004554]|Usher syndrome type 1C [RCV000669659] Chr11:17531230 [GRCh38]
Chr11:17552777 [GRCh37]
Chr11:11p15.1
likely pathogenic|uncertain significance
NM_153676.4(USH1C):c.2528dup (p.Glu844fs) duplication Usher syndrome type 1C [RCV000668827] Chr11:17496775..17496776 [GRCh38]
Chr11:17518322..17518323 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.674+1G>A single nucleotide variant Usher syndrome type 1C [RCV000668959]|not provided [RCV001855510] Chr11:17526346 [GRCh38]
Chr11:17547893 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.674+2T>G single nucleotide variant Usher syndrome type 1C [RCV000669773]|not provided [RCV001855529] Chr11:17526345 [GRCh38]
Chr11:17547892 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.877-1G>A single nucleotide variant Usher syndrome type 1C [RCV000669286] Chr11:17522927 [GRCh38]
Chr11:17544474 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1559dup (p.Ser521fs) duplication Usher syndrome type 1C [RCV000669499]|not provided [RCV000813024] Chr11:17509809..17509810 [GRCh38]
Chr11:17531356..17531357 [GRCh37]
Chr11:11p15.1
pathogenic|uncertain significance
NM_153676.4(USH1C):c.674+1del deletion Usher syndrome type 1C [RCV000669966] Chr11:17526346 [GRCh38]
Chr11:17547893 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1414-34G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538022]|Usher syndrome type 1C [RCV001538021]|not provided [RCV000829568]|not specified [RCV000253781] Chr11:17510555 [GRCh38]
Chr11:17532102 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-47G>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537956]|Usher syndrome type 1C [RCV001537955]|not provided [RCV000835203]|not specified [RCV000251378] Chr11:17533369 [GRCh38]
Chr11:17554916 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2656-47C>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV002244710]|Usher syndrome type 1C [RCV002244709]|not provided [RCV000829571]|not specified [RCV000241835] Chr11:17494423 [GRCh38]
Chr11:17515970 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-45C>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537954]|Usher syndrome type 1C [RCV001537953]|not provided [RCV000829562]|not specified [RCV000246628] Chr11:17533367 [GRCh38]
Chr11:17554914 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.*46T>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537978]|Usher syndrome type 1C [RCV000294252]|not provided [RCV001711840]|not specified [RCV000244578] Chr11:17494286 [GRCh38]
Chr11:17515833 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.496+33= single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537952]|Usher syndrome type 1C [RCV001537951]|not provided [RCV000829563]|not specified [RCV000244811] Chr11:17527190 [GRCh38]
Chr11:17548737 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.841_848del (p.Ser281fs) deletion Usher syndrome type 1C [RCV000672216]|Usher syndrome type 2 [RCV001199564]|not provided [RCV000487515] Chr11:17523239..17523246 [GRCh38]
Chr11:17544786..17544793 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.2381-46G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538012]|Usher syndrome type 1C [RCV001538011]|not provided [RCV001651277]|not specified [RCV000250374] Chr11:17498317 [GRCh38]
Chr11:17519864 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.580-27G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537946]|Usher syndrome type 1C [RCV001537945]|not provided [RCV001668608]|not specified [RCV000252696] Chr11:17526468 [GRCh38]
Chr11:17548015 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.7C>T (p.Arg3Ter) single nucleotide variant Usher syndrome type 1C [RCV000240666] Chr11:17544301 [GRCh38]
Chr11:17565848 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.522-45del deletion Autosomal recessive nonsyndromic hearing loss 18A [RCV002244712]|Usher syndrome type 1C [RCV002244711]|not provided [RCV001640581]|not specified [RCV000247936] Chr11:17526855 [GRCh38]
Chr11:17548402 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.883G>A (p.Glu295Lys) single nucleotide variant Usher syndrome type 1C [RCV000377276] Chr11:17522920 [GRCh38]
Chr11:17544467 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*211A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537976]|Usher syndrome type 1C [RCV000358662]|not provided [RCV001597054] Chr11:17494121 [GRCh38]
Chr11:17515668 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.759+10G>T single nucleotide variant Usher syndrome type 1C [RCV000361591]|not provided [RCV000927201] Chr11:17524441 [GRCh38]
Chr11:17545988 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2265C>G (p.Leu755=) single nucleotide variant Usher syndrome type 1C [RCV000383252]|not provided [RCV002056182] Chr11:17501497 [GRCh38]
Chr11:17523044 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.*42C>T single nucleotide variant Usher syndrome type 1C [RCV000290445]|not provided [RCV001582938] Chr11:17494290 [GRCh38]
Chr11:17515837 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.464G>C (p.Arg155Pro) single nucleotide variant Usher syndrome type 1C [RCV000292237] Chr11:17527255 [GRCh38]
Chr11:17548802 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*419_*420insAACA insertion Nonsyndromic Hearing Loss, Recessive [RCV000292469]|Retinitis pigmentosa-deafness syndrome [RCV000347392] Chr11:17493912..17493913 [GRCh38]
Chr11:17515459..17515460 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.-71T>G single nucleotide variant Usher syndrome type 1C [RCV000277531] Chr11:17544378 [GRCh38]
Chr11:17565925 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.496C>T (p.His166Tyr) single nucleotide variant Usher syndrome type 1C [RCV000334139]|not provided [RCV001850606] Chr11:17527223 [GRCh38]
Chr11:17548770 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1175G>A single nucleotide variant Usher syndrome type 1C [RCV000297479]|not provided [RCV000914270]|not specified [RCV001700046] Chr11:17517465 [GRCh38]
Chr11:17539012 [GRCh37]
Chr11:11p15.1
benign|likely benign|uncertain significance
NM_153676.4(USH1C):c.*186C>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537977]|Usher syndrome type 1C [RCV000319324]|not provided [RCV001711780] Chr11:17494146 [GRCh38]
Chr11:17515693 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.851T>A (p.Leu284Gln) single nucleotide variant Usher syndrome type 1C [RCV000373963] Chr11:17523236 [GRCh38]
Chr11:17544783 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.-60T>C single nucleotide variant Usher syndrome type 1C [RCV000298733]|not provided [RCV001683222] Chr11:17544367 [GRCh38]
Chr11:17565914 [GRCh37]
Chr11:11p15.1
benign|uncertain significance
NM_153676.4(USH1C):c.2378A>G (p.His793Arg) single nucleotide variant Usher syndrome type 1C [RCV000353901] Chr11:17501053 [GRCh38]
Chr11:17522600 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.105-4A>G single nucleotide variant Usher syndrome type 1C [RCV000299965]|not provided [RCV001431048] Chr11:17531546 [GRCh38]
Chr11:17553093 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.881G>A (p.Arg294Gln) single nucleotide variant Usher syndrome type 1C [RCV000263955] Chr11:17522922 [GRCh38]
Chr11:17544469 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*140C>T single nucleotide variant Usher syndrome type 1C [RCV000355344] Chr11:17494192 [GRCh38]
Chr11:17515739 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.789C>G (p.Gly263=) single nucleotide variant Usher syndrome type 1C [RCV000346576]|not provided [RCV002056183] Chr11:17523449 [GRCh38]
Chr11:17544996 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1512T>C (p.Ala504=) single nucleotide variant not provided [RCV000309939] Chr11:17510423 [GRCh38]
Chr11:17531970 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2280+15G>A single nucleotide variant Usher syndrome type 1C [RCV000273406] Chr11:17501467 [GRCh38]
Chr11:17523014 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.275G>A (p.Arg92His) single nucleotide variant Usher syndrome type 1C [RCV001828246]|not provided [RCV000349369] Chr11:17531266 [GRCh38]
Chr11:17552813 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*405C>G single nucleotide variant Usher syndrome type 1C [RCV000307844] Chr11:17493927 [GRCh38]
Chr11:17515474 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.406C>T (p.Arg136Trp) single nucleotide variant Usher syndrome type 1C [RCV000383021]|not provided [RCV001246612]|not specified [RCV000825486] Chr11:17527313 [GRCh38]
Chr11:17548860 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.790G>A (p.Val264Ile) single nucleotide variant Usher syndrome type 1C [RCV000310482]|not provided [RCV001068380]|not specified [RCV000825027] Chr11:17523448 [GRCh38]
Chr11:17544995 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.*95C>T single nucleotide variant Usher syndrome type 1C [RCV000333987] Chr11:17494237 [GRCh38]
Chr11:17515784 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.845G>A (p.Arg282His) single nucleotide variant Usher syndrome type 1C [RCV000389039]|not provided [RCV001208196] Chr11:17523242 [GRCh38]
Chr11:17544789 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1531A>C (p.Met511Leu) single nucleotide variant not provided [RCV000365630] Chr11:17509838 [GRCh38]
Chr11:17531385 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.880C>T (p.Arg294Trp) single nucleotide variant Usher syndrome type 1C [RCV001108555]|not provided [RCV000403434] Chr11:17522923 [GRCh38]
Chr11:17544470 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1942G>A (p.Glu648Lys) single nucleotide variant not provided [RCV000367555] Chr11:17509427 [GRCh38]
Chr11:17530974 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2443C>T (p.Leu815=) single nucleotide variant Usher syndrome type 1C [RCV001833311]|not provided [RCV000724931]|not specified [RCV000405725] Chr11:17498209 [GRCh38]
Chr11:17519756 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.820-51G>A single nucleotide variant not provided [RCV001547265] Chr11:17523318 [GRCh38]
Chr11:17544865 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.*376A>C single nucleotide variant Usher syndrome type 1C [RCV000362287] Chr11:17493956 [GRCh38]
Chr11:17515503 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.634G>A (p.Val212Ile) single nucleotide variant Usher syndrome type 1C [RCV000354977]|not provided [RCV001859803] Chr11:17526387 [GRCh38]
Chr11:17547934 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.92G>A (p.Arg31Gln) single nucleotide variant Usher syndrome type 1 [RCV000625797]|not provided [RCV002225694] Chr11:17533267 [GRCh38]
Chr11:17554814 [GRCh37]
Chr11:11p15.1
likely pathogenic|likely benign
NM_153676.4(USH1C):c.66G>A (p.Glu22=) single nucleotide variant Usher syndrome type 1C [RCV001108638]|not provided [RCV001411031]|not specified [RCV000605324] Chr11:17533293 [GRCh38]
Chr11:17554840 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1039C>T (p.Gln347Ter) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000984229]|Usher syndrome type 1C [RCV000984228]|not provided [RCV000598390] Chr11:17521392 [GRCh38]
Chr11:17542939 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.2280+6del deletion Usher syndrome type 1C [RCV001835876]|not specified [RCV000603989] Chr11:17501476 [GRCh38]
Chr11:17523023 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1260+7C>T single nucleotide variant not specified [RCV000604850] Chr11:17516234 [GRCh38]
Chr11:17537781 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1199G>A (p.Arg400His) single nucleotide variant Usher syndrome type 1C [RCV001829674]|not provided [RCV000597888] Chr11:17520881 [GRCh38]
Chr11:17542428 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.-15G>C single nucleotide variant not specified [RCV000605543] Chr11:17544322 [GRCh38]
Chr11:17565869 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.445G>A (p.Glu149Lys) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000735664] Chr11:17527274 [GRCh38]
Chr11:17548821 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.496+1G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000412131]|Inborn genetic diseases [RCV001266797]|Usher syndrome type 1C [RCV000411458]|not provided [RCV001240003] Chr11:17527222 [GRCh38]
Chr11:17548769 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.2226+2T>C single nucleotide variant not provided [RCV000594339] Chr11:17501937 [GRCh38]
Chr11:17523484 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.463C>T (p.Arg155Ter) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000409966]|Hearing loss, autosomal recessive [RCV001291494]|Usher syndrome type 1C [RCV000412375]|not provided [RCV001865277] Chr11:17527256 [GRCh38]
Chr11:17548803 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.1570C>T (p.Pro524Ser) single nucleotide variant not provided [RCV000734150] Chr11:17509799 [GRCh38]
Chr11:17531346 [GRCh37]
Chr11:11p15.1
uncertain significance
NC_000011.9:g.17552956G>GG single nucleotide variant not provided [RCV000727619] Chr11:17531408..17531409 [GRCh38]
Chr11:17552956 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.440A>G (p.His147Arg) single nucleotide variant Usher syndrome [RCV000504748]|Usher syndrome type 1C [RCV000674162]|not provided [RCV001857200] Chr11:17527279 [GRCh38]
Chr11:17548826 [GRCh37]
Chr11:11p15.1
likely pathogenic|uncertain significance
NM_153676.4(USH1C):c.748_759+5del deletion Usher syndrome [RCV000504842]|Usher syndrome type 1C [RCV000673343]|not provided [RCV001377936] Chr11:17524446..17524462 [GRCh38]
Chr11:17545993..17546009 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.105G>C (p.Gln35His) single nucleotide variant not provided [RCV000728072] Chr11:17531542 [GRCh38]
Chr11:17553089 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.1(chr11:16820813-18103432)x3 copy number gain See cases [RCV000449180] Chr11:16820813..18103432 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.396C>T (p.Asp132=) single nucleotide variant not provided [RCV001394543] Chr11:17527323 [GRCh38]
Chr11:17548870 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2380+1G>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000735772]|not specified [RCV000455318] Chr11:17501050 [GRCh38]
Chr11:17522597 [GRCh37]
Chr11:11p15.1
pathogenic|uncertain significance
GRCh37/hg19 11p15.5-12(chr11:230615-37698540)x3 copy number gain See cases [RCV000511561] Chr11:230615..37698540 [GRCh37]
Chr11:11p15.5-12
pathogenic
NM_153676.4(USH1C):c.701C>T (p.Pro234Leu) single nucleotide variant not specified [RCV000506416] Chr11:17524509 [GRCh38]
Chr11:17546056 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.5-q25(chr11:230616-134938470) copy number gain See cases [RCV000511729] Chr11:230616..134938470 [GRCh37]
Chr11:11p15.5-q25
pathogenic
NM_153676.4(USH1C):c.1020-7G>A single nucleotide variant not provided [RCV001451028]|not specified [RCV000507988] Chr11:17521418 [GRCh38]
Chr11:17542965 [GRCh37]
Chr11:11p15.1
likely benign
GRCh37/hg19 11p15.1(chr11:17142196-18014467)x3 copy number gain See cases [RCV000511047] Chr11:17142196..18014467 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.266G>A (p.Arg89His) single nucleotide variant Usher syndrome type 1C [RCV000669302]|Usher syndrome type 1C [RCV001273253]|not provided [RCV001071473]|not specified [RCV001731869] Chr11:17531275 [GRCh38]
Chr11:17552822 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2490+1del deletion Usher syndrome type 1C [RCV000670352] Chr11:17498161 [GRCh38]
Chr11:17519708 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.5-q25(chr11:230616-134938470)x3 copy number gain See cases [RCV000510881] Chr11:230616..134938470 [GRCh37]
Chr11:11p15.5-q25
pathogenic
NM_153676.4(USH1C):c.1807dup (p.Ile603fs) duplication Usher syndrome type 1C [RCV000669023] Chr11:17509561..17509562 [GRCh38]
Chr11:17531108..17531109 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_005709.4(USH1C):c.1284+6880del deletion Usher syndrome type 1C [RCV000669692] Chr11:17510521 [GRCh38]
Chr11:17532068 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2661TCT[1] (p.Leu889del) microsatellite Usher syndrome type 1C [RCV000669821]|not provided [RCV001322742] Chr11:17494366..17494368 [GRCh38]
Chr11:17515913..17515915 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.760-1G>T single nucleotide variant Usher syndrome type 1C [RCV000669103] Chr11:17523479 [GRCh38]
Chr11:17545026 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.2138A>G (p.Gln713Arg) single nucleotide variant not provided [RCV000578867] Chr11:17504693 [GRCh38]
Chr11:17526240 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1739_1744del (p.Pro580_Val581del) deletion Usher syndrome type 1C [RCV000672004] Chr11:17509625..17509630 [GRCh38]
Chr11:17531172..17531177 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1712_1716dup (p.Pro573fs) duplication Usher syndrome type 1C [RCV000672096] Chr11:17509652..17509653 [GRCh38]
Chr11:17531199..17531200 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2265C>T (p.Leu755=) single nucleotide variant Usher syndrome type 1C [RCV001829670]|not provided [RCV000594031] Chr11:17501497 [GRCh38]
Chr11:17523044 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.669C>A (p.Gly223=) single nucleotide variant Usher syndrome type 1C [RCV001103387]|not provided [RCV000595340] Chr11:17526352 [GRCh38]
Chr11:17547899 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.1824G>C (p.Pro608=) single nucleotide variant not specified [RCV000607067] Chr11:17509545 [GRCh38]
Chr11:17531092 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1907G>A (p.Arg636His) single nucleotide variant not specified [RCV000616006] Chr11:17509462 [GRCh38]
Chr11:17531009 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2288C>T (p.Ser763Phe) single nucleotide variant Usher syndrome type 1C [RCV001829696]|not specified [RCV000610132] Chr11:17501143 [GRCh38]
Chr11:17522690 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2568A>G (p.Val856=) single nucleotide variant not provided [RCV000930130]|not specified [RCV000610204] Chr11:17495656 [GRCh38]
Chr11:17517203 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2630G>A (p.Gly877Glu) single nucleotide variant not provided [RCV001474632]|not specified [RCV000601958] Chr11:17495594 [GRCh38]
Chr11:17517141 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.497-3C>A single nucleotide variant Usher syndrome type 1C [RCV001829702]|not provided [RCV001064690]|not specified [RCV000610316] Chr11:17527043 [GRCh38]
Chr11:17548590 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.675-4G>A single nucleotide variant not provided [RCV000932122]|not specified [RCV000607812] Chr11:17524539 [GRCh38]
Chr11:17546086 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2046C>T (p.Gly682=) single nucleotide variant not specified [RCV000610518] Chr11:17505917 [GRCh38]
Chr11:17527464 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.521+14C>G single nucleotide variant not specified [RCV000607853] Chr11:17527002 [GRCh38]
Chr11:17548549 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1699C>T (p.Pro567Ser) single nucleotide variant not specified [RCV000613385] Chr11:17509670 [GRCh38]
Chr11:17531217 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2616C>T (p.Ala872=) single nucleotide variant not provided [RCV001584411]|not specified [RCV000613425] Chr11:17495608 [GRCh38]
Chr11:17517155 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1548G>C (p.Pro516=) single nucleotide variant not specified [RCV000616821] Chr11:17509821 [GRCh38]
Chr11:17531368 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2551T>G (p.Ser851Ala) single nucleotide variant not provided [RCV000910503]|not specified [RCV000600877] Chr11:17495673 [GRCh38]
Chr11:17517220 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.238C>G (p.Arg80Gly) single nucleotide variant Usher syndrome type 1C [RCV001829714]|not provided [RCV001346255]|not specified [RCV000613861] Chr11:17531409 [GRCh38]
Chr11:17552956 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.164G>A (p.Arg55His) single nucleotide variant Usher syndrome type 1C [RCV001106432]|not specified [RCV000614227] Chr11:17531483 [GRCh38]
Chr11:17553030 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1516A>G (p.Asn506Asp) single nucleotide variant not specified [RCV000611534] Chr11:17510419 [GRCh38]
Chr11:17531966 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.672C>A (p.Cys224Ter) single nucleotide variant Usher syndrome type 1C [RCV000672382]|not provided [RCV001055312] Chr11:17526349 [GRCh38]
Chr11:17547896 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
GRCh37/hg19 11p15.5-14.3(chr11:230615-25584362)x3 copy number gain See cases [RCV000512225] Chr11:230615..25584362 [GRCh37]
Chr11:11p15.5-14.3
pathogenic
NM_153676.4(USH1C):c.360C>T (p.Gly120=) single nucleotide variant Usher syndrome type 1C [RCV001276297]|not provided [RCV000595046] Chr11:17531181 [GRCh38]
Chr11:17552728 [GRCh37]
Chr11:11p15.1
conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 11p15.5-13(chr11:230615-31995219)x3 copy number gain See cases [RCV000512477] Chr11:230615..31995219 [GRCh37]
Chr11:11p15.5-13
pathogenic
NM_153676.4(USH1C):c.2546+1G>T single nucleotide variant Usher syndrome type 1C [RCV000664592]|not provided [RCV001201442] Chr11:17496757 [GRCh38]
Chr11:17518304 [GRCh37]
Chr11:11p15.1
likely pathogenic|uncertain significance
NM_153676.4(USH1C):c.104+1G>A single nucleotide variant Usher syndrome type 1C [RCV000671948]|not provided [RCV001057158] Chr11:17533254 [GRCh38]
Chr11:17554801 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1265del (p.Gly422fs) deletion Usher syndrome type 1C [RCV000672149] Chr11:17512050 [GRCh38]
Chr11:17533597 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2490+2T>C single nucleotide variant Usher syndrome type 1C [RCV000672856] Chr11:17498160 [GRCh38]
Chr11:17519707 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1806del (p.Ile603fs) deletion Usher syndrome type 1C [RCV000672947] Chr11:17509563 [GRCh38]
Chr11:17531110 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1415_1416insCTGAGACCCCCTGG (p.Val472_Ser473insTer) insertion Usher syndrome type 1C [RCV000673012] Chr11:17510519..17510520 [GRCh38]
Chr11:17532066..17532067 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.187C>T (p.Arg63Trp) single nucleotide variant Usher syndrome type 1C [RCV000664634] Chr11:17531460 [GRCh38]
Chr11:17553007 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1806dup (p.Ile603fs) duplication Usher syndrome type 1C [RCV000672492] Chr11:17509562..17509563 [GRCh38]
Chr11:17531109..17531110 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1543CCCCCGCCT[3] (p.Pro518_Pro520dup) microsatellite Usher syndrome type 1C [RCV000672560] Chr11:17509808..17509809 [GRCh38]
Chr11:17531355..17531356 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.388-8T>A single nucleotide variant Usher syndrome type 1C [RCV000671106] Chr11:17527339 [GRCh38]
Chr11:17548886 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2431_2451del (p.Thr811_Glu817del) deletion Usher syndrome type 1C [RCV000670796]|not provided [RCV001855547] Chr11:17498201..17498221 [GRCh38]
Chr11:17519748..17519768 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1175del deletion Retinitis pigmentosa [RCV001003245]|Usher syndrome type 1C [RCV000670807]|Usher syndrome type 1C [RCV001829866]|not provided [RCV001386148] Chr11:17517465 [GRCh38]
Chr11:17539012 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.2326dup (p.Ile776fs) duplication Usher syndrome type 1C [RCV000670894]|not provided [RCV001232682] Chr11:17501104..17501105 [GRCh38]
Chr11:17522651..17522652 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.1351AAAGAG[1] (p.451KE[1]) microsatellite Usher syndrome type 1C [RCV000671696] Chr11:17511953..17511958 [GRCh38]
Chr11:17533500..17533505 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2681del (p.Gly894fs) deletion Usher syndrome type 1C [RCV000667903] Chr11:17494351 [GRCh38]
Chr11:17515898 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2281-1G>A single nucleotide variant Usher syndrome type 1C [RCV000668048] Chr11:17501151 [GRCh38]
Chr11:17522698 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.2490+1G>T single nucleotide variant Usher syndrome type 1C [RCV000674078]|not provided [RCV001861833] Chr11:17498161 [GRCh38]
Chr11:17519708 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.2656-1G>A single nucleotide variant Usher syndrome type 1C [RCV000668302] Chr11:17494377 [GRCh38]
Chr11:17515924 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.793G>A (p.Asp265Asn) single nucleotide variant Usher syndrome type 1C [RCV000668427] Chr11:17523445 [GRCh38]
Chr11:17544992 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.248+1G>A single nucleotide variant Usher syndrome type 1C [RCV000671298]|not provided [RCV001855556] Chr11:17531398 [GRCh38]
Chr11:17552945 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.2281-2A>G single nucleotide variant Usher syndrome type 1C [RCV000668530] Chr11:17501152 [GRCh38]
Chr11:17522699 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.915_920del (p.Glu306_Ala307del) deletion Usher syndrome type 1C [RCV000668637] Chr11:17522883..17522888 [GRCh38]
Chr11:17544430..17544435 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.496+1G>T single nucleotide variant Usher syndrome type 1C [RCV000666962]|Usher syndrome type 1C [RCV001829837]|not provided [RCV001090231] Chr11:17527222 [GRCh38]
Chr11:17548769 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.1414-2_1414-1insCTG insertion Usher syndrome type 1C [RCV000673013] Chr11:17510522..17510523 [GRCh38]
Chr11:17532069..17532070 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2487C>T (p.Gly829=) single nucleotide variant Usher syndrome type 1C [RCV000673137]|Usher syndrome type 1C [RCV001108479]|not provided [RCV000898027] Chr11:17498165 [GRCh38]
Chr11:17519712 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2041C>T (p.Arg681Ter) single nucleotide variant Usher syndrome type 1C [RCV000664966]|not provided [RCV001397163] Chr11:17505922 [GRCh38]
Chr11:17527469 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2089G>T (p.Glu697Ter) single nucleotide variant Usher syndrome type 1C [RCV000669167] Chr11:17505874 [GRCh38]
Chr11:17527421 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1139del (p.Gly379_Ser380insTer) deletion Usher syndrome type 1C [RCV000669236]|not provided [RCV001385798] Chr11:17520941 [GRCh38]
Chr11:17542488 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.1556C>T (p.Pro519Leu) single nucleotide variant Usher syndrome type 1C [RCV000665295]|not provided [RCV002060812] Chr11:17509813 [GRCh38]
Chr11:17531360 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2688_2695dup (p.Arg899fs) duplication Usher syndrome type 1C [RCV000670831] Chr11:17494336..17494337 [GRCh38]
Chr11:17515883..17515884 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1290T>G (p.Tyr430Ter) single nucleotide variant Usher syndrome type 1C [RCV000671918]|not provided [RCV000929263] Chr11:17512025 [GRCh38]
Chr11:17533572 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2006_2010del (p.Thr669fs) deletion Usher syndrome type 1C [RCV000674222] Chr11:17509359..17509363 [GRCh38]
Chr11:17530906..17530910 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1146dup (p.Gln383fs) duplication Usher syndrome type 1C [RCV000671259]|not provided [RCV001527771] Chr11:17520933..17520934 [GRCh38]
Chr11:17542480..17542481 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.819+1G>A single nucleotide variant Usher syndrome type 1C [RCV000674242] Chr11:17523418 [GRCh38]
Chr11:17544965 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1871C>A (p.Ser624Ter) single nucleotide variant Usher syndrome type 1C [RCV000674264] Chr11:17509498 [GRCh38]
Chr11:17531045 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.598G>A (p.Gly200Ser) single nucleotide variant Usher syndrome type 1C [RCV000671786] Chr11:17526423 [GRCh38]
Chr11:17547970 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1840del (p.Gln614fs) deletion Usher syndrome type 1C [RCV000668066] Chr11:17509529 [GRCh38]
Chr11:17531076 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2381-2A>G single nucleotide variant Usher syndrome type 1C [RCV000673327] Chr11:17498273 [GRCh38]
Chr11:17519820 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1016G>A (p.Arg339Gln) single nucleotide variant Usher syndrome type 1C [RCV000666051] Chr11:17522787 [GRCh38]
Chr11:17544334 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1216G>T (p.Gly406Ter) single nucleotide variant Usher syndrome type 1C [RCV000672415] Chr11:17516285 [GRCh38]
Chr11:17537832 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1654_1660del (p.Tyr552fs) deletion Usher syndrome type 1C [RCV000666295] Chr11:17509709..17509715 [GRCh38]
Chr11:17531256..17531262 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1413+2T>C single nucleotide variant Usher syndrome type 1C [RCV000674329] Chr11:17511900 [GRCh38]
Chr11:17533447 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1292G>T (p.Gly431Val) single nucleotide variant Usher syndrome type 1C [RCV000665116]|not provided [RCV001432840] Chr11:17512023 [GRCh38]
Chr11:17533570 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2227-1G>T single nucleotide variant Usher syndrome type 1C [RCV000666443]|not provided [RCV001868213] Chr11:17501536 [GRCh38]
Chr11:17523083 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1824del (p.Pro609fs) deletion Usher syndrome type 1C [RCV000674234] Chr11:17509545 [GRCh38]
Chr11:17531092 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2547-1G>T single nucleotide variant Usher syndrome type 1C [RCV000665878]|not provided [RCV000928159] Chr11:17495678 [GRCh38]
Chr11:17517225 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1020-2A>C single nucleotide variant Usher syndrome type 1C [RCV000666800]|Usher syndrome type 1C [RCV001273250]|not provided [RCV001049314] Chr11:17521413 [GRCh38]
Chr11:17542960 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1363G>T (p.Glu455Ter) single nucleotide variant Usher syndrome type 1C [RCV000674797] Chr11:17511952 [GRCh38]
Chr11:17533499 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1840C>T (p.Gln614Ter) single nucleotide variant Usher syndrome type 1C [RCV000665151] Chr11:17509529 [GRCh38]
Chr11:17531076 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.579+1G>C single nucleotide variant Usher syndrome type 1C [RCV000666602]|not provided [RCV001067026] Chr11:17526752 [GRCh38]
Chr11:17548299 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
GRCh37/hg19 11p15.1(chr11:17120357-17579212)x3 copy number gain not provided [RCV000683336] Chr11:17120357..17579212 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.1(chr11:17527585-18606820)x1 copy number loss not provided [RCV000683355] Chr11:17527585..18606820 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.5-q25(chr11:198510-134934063)x3 copy number gain not provided [RCV000737348] Chr11:198510..134934063 [GRCh37]
Chr11:11p15.5-q25
pathogenic
GRCh37/hg19 11p15.5-q25(chr11:70864-134938470)x3 copy number gain not provided [RCV000749874] Chr11:70864..134938470 [GRCh37]
Chr11:11p15.5-q25
pathogenic
NM_153676.4(USH1C):c.388-255C>T single nucleotide variant not provided [RCV001585521] Chr11:17527586 [GRCh38]
Chr11:17549133 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2184+21T>G single nucleotide variant Usher syndrome type 1C [RCV001832804]|not provided [RCV001586643] Chr11:17504626 [GRCh38]
Chr11:17526173 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.579+114G>A single nucleotide variant not provided [RCV001707332] Chr11:17526639 [GRCh38]
Chr11:17548186 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-44dup duplication not provided [RCV001690371] Chr11:17533363..17533364 [GRCh38]
Chr11:17554910..17554911 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.579+31G>C single nucleotide variant not provided [RCV001690372] Chr11:17526722 [GRCh38]
Chr11:17548269 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-48G>T single nucleotide variant not provided [RCV001585128] Chr11:17533370 [GRCh38]
Chr11:17554917 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1085+173G>A single nucleotide variant not provided [RCV001586198] Chr11:17521173 [GRCh38]
Chr11:17542720 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2227-118T>G single nucleotide variant not provided [RCV001546136] Chr11:17501653 [GRCh38]
Chr11:17523200 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2269C>T (p.Arg757Cys) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001578833]|Usher syndrome type 1C [RCV001578834] Chr11:17501493 [GRCh38]
Chr11:17523040 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*1G>C single nucleotide variant not provided [RCV001547930] Chr11:17494331 [GRCh38]
Chr11:17515878 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1211-1159C>T single nucleotide variant Usher syndrome type 1C [RCV001836046]|not provided [RCV000976406] Chr11:17517449 [GRCh38]
Chr11:17538996 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.876+33G>A single nucleotide variant not provided [RCV001725691] Chr11:17523178 [GRCh38]
Chr11:17544725 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2656-159del deletion not provided [RCV001648059] Chr11:17494535 [GRCh38]
Chr11:17516082 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-49_37-48insC insertion not provided [RCV001571045] Chr11:17533370..17533371 [GRCh38]
Chr11:17554917..17554918 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.580-148C>T single nucleotide variant not provided [RCV001678673] Chr11:17526589 [GRCh38]
Chr11:17548136 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.759+116G>A single nucleotide variant not provided [RCV001583148] Chr11:17524335 [GRCh38]
Chr11:17545882 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1691T>C (p.Met564Thr) single nucleotide variant not provided [RCV000925080] Chr11:17509678 [GRCh38]
Chr11:17531225 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2199T>C (p.Tyr733=) single nucleotide variant not provided [RCV000923940] Chr11:17501966 [GRCh38]
Chr11:17523513 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1349A>G (p.Tyr450Cys) single nucleotide variant not provided [RCV000929576] Chr11:17511966 [GRCh38]
Chr11:17533513 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.540C>T (p.Leu180=) single nucleotide variant Usher syndrome type 1C [RCV001105300]|not provided [RCV000924097] Chr11:17526792 [GRCh38]
Chr11:17548339 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1637T>A (p.Ile546Asn) single nucleotide variant not provided [RCV000928673] Chr11:17509732 [GRCh38]
Chr11:17531279 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1414G>A (p.Val472Met) single nucleotide variant not provided [RCV000923341] Chr11:17510521 [GRCh38]
Chr11:17532068 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1859G>A (p.Arg620His) single nucleotide variant not provided [RCV000942072] Chr11:17509510 [GRCh38]
Chr11:17531057 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1831G>T (p.Val611Phe) single nucleotide variant not provided [RCV000942089] Chr11:17509538 [GRCh38]
Chr11:17531085 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity
NM_153676.4(USH1C):c.1768G>A (p.Ala590Thr) single nucleotide variant not provided [RCV000920053] Chr11:17509601 [GRCh38]
Chr11:17531148 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity
NM_153676.4(USH1C):c.1560T>C (p.Pro520=) single nucleotide variant not provided [RCV000975543] Chr11:17509809 [GRCh38]
Chr11:17531356 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1368G>A (p.Met456Ile) single nucleotide variant not provided [RCV000926855] Chr11:17511947 [GRCh38]
Chr11:17533494 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.521+7G>A single nucleotide variant not provided [RCV000983175] Chr11:17527009 [GRCh38]
Chr11:17548556 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1490G>T (p.Arg497Leu) single nucleotide variant not provided [RCV000925052] Chr11:17510445 [GRCh38]
Chr11:17531992 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2566G>A (p.Val856Ile) single nucleotide variant not provided [RCV000905172] Chr11:17495658 [GRCh38]
Chr11:17517205 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2400C>T (p.Asp800=) single nucleotide variant Usher syndrome type 1C [RCV001827119]|not provided [RCV000983219] Chr11:17498252 [GRCh38]
Chr11:17519799 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2585C>T (p.Pro862Leu) single nucleotide variant not provided [RCV000927672] Chr11:17495639 [GRCh38]
Chr11:17517186 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.492G>A (p.Val164=) single nucleotide variant not provided [RCV000926521] Chr11:17527227 [GRCh38]
Chr11:17548774 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1472A>G (p.Glu491Gly) single nucleotide variant not provided [RCV000921590] Chr11:17510463 [GRCh38]
Chr11:17532010 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.675-7C>T single nucleotide variant not provided [RCV000944346] Chr11:17524542 [GRCh38]
Chr11:17546089 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2039C>A (p.Pro680Gln) single nucleotide variant not provided [RCV000944385] Chr11:17505924 [GRCh38]
Chr11:17527471 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity
NM_153676.4(USH1C):c.1386G>A (p.Gln462=) single nucleotide variant not provided [RCV000883516]|not specified [RCV001195474] Chr11:17511929 [GRCh38]
Chr11:17533476 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.192G>A (p.Pro64=) single nucleotide variant Usher syndrome type 1C [RCV001106430]|not provided [RCV000981080] Chr11:17531455 [GRCh38]
Chr11:17553002 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.759+9C>T single nucleotide variant not provided [RCV000928343] Chr11:17524442 [GRCh38]
Chr11:17545989 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2635C>T (p.Leu879Phe) single nucleotide variant not provided [RCV000976989] Chr11:17495589 [GRCh38]
Chr11:17517136 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1531-3del deletion not provided [RCV000944570] Chr11:17509841 [GRCh38]
Chr11:17531388 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1664C>G (p.Pro555Arg) single nucleotide variant not provided [RCV000922579] Chr11:17509705 [GRCh38]
Chr11:17531252 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2374C>A (p.Arg792=) single nucleotide variant Usher syndrome type 1C [RCV001276291]|not provided [RCV000928376] Chr11:17501057 [GRCh38]
Chr11:17522604 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1600G>A (p.Gly534Ser) single nucleotide variant not provided [RCV000944339] Chr11:17509769 [GRCh38]
Chr11:17531316 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.560del (p.Gln187fs) deletion Retinal dystrophy [RCV001073238] Chr11:17526772 [GRCh38]
Chr11:17548319 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.491_492del (p.Val164fs) deletion Retinal dystrophy [RCV001073795]|not provided [RCV001237148] Chr11:17527227..17527228 [GRCh38]
Chr11:17548774..17548775 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NC_000011.10:g.(?_17533688)_(17645944_?)dup duplication not provided [RCV001033624] Chr11:17555235..17667491 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2281G>A (p.Glu761Lys) single nucleotide variant Usher syndrome type 1C [RCV001272251]|not provided [RCV001049176] Chr11:17501150 [GRCh38]
Chr11:17522697 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2352_2353del (p.Val784_Tyr785insTer) microsatellite Autosomal recessive nonsyndromic hearing loss 18A [RCV000770885] Chr11:17501078..17501079 [GRCh38]
Chr11:17522625..17522626 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.1703C>T (p.Pro568Leu) single nucleotide variant not provided [RCV000929671]|not specified [RCV000826071] Chr11:17509666 [GRCh38]
Chr11:17531213 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2577C>A (p.Ser859Arg) single nucleotide variant not specified [RCV000826072] Chr11:17495647 [GRCh38]
Chr11:17517194 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1495G>A (p.Glu499Lys) single nucleotide variant not provided [RCV000895584] Chr11:17510440 [GRCh38]
Chr11:17531987 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2094C>A (p.Pro698=) single nucleotide variant not provided [RCV000978197] Chr11:17505869 [GRCh38]
Chr11:17527416 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2184+7T>C single nucleotide variant not provided [RCV000920755] Chr11:17504640 [GRCh38]
Chr11:17526187 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.888G>A (p.Leu296=) single nucleotide variant not provided [RCV000895728] Chr11:17522915 [GRCh38]
Chr11:17544462 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.795C>T (p.Asp265=) single nucleotide variant not provided [RCV000980516] Chr11:17523443 [GRCh38]
Chr11:17544990 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.36+10G>T single nucleotide variant not provided [RCV000981898] Chr11:17544262 [GRCh38]
Chr11:17565809 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.675-5C>T single nucleotide variant not provided [RCV000930891] Chr11:17524540 [GRCh38]
Chr11:17546087 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1221G>C (p.Trp407Cys) single nucleotide variant not provided [RCV000941554] Chr11:17516280 [GRCh38]
Chr11:17537827 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2442C>G (p.Thr814=) single nucleotide variant not provided [RCV000982035] Chr11:17498210 [GRCh38]
Chr11:17519757 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1868C>A (p.Pro623His) single nucleotide variant not provided [RCV000979329] Chr11:17509501 [GRCh38]
Chr11:17531048 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1823C>T (p.Pro608Leu) single nucleotide variant not provided [RCV000978344] Chr11:17509546 [GRCh38]
Chr11:17531093 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1989A>G (p.Glu663=) single nucleotide variant not provided [RCV000942692] Chr11:17509380 [GRCh38]
Chr11:17530927 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1236T>C (p.Asp412=) single nucleotide variant not provided [RCV000944244] Chr11:17516265 [GRCh38]
Chr11:17537812 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1820C>T (p.Pro607Leu) single nucleotide variant not provided [RCV000931927] Chr11:17509549 [GRCh38]
Chr11:17531096 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2373G>A (p.Glu791=) single nucleotide variant Usher syndrome type 1C [RCV001832142]|not provided [RCV000939713] Chr11:17501058 [GRCh38]
Chr11:17522605 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.2155A>G (p.Met719Val) single nucleotide variant not provided [RCV000942080] Chr11:17504676 [GRCh38]
Chr11:17526223 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1399C>T (p.Arg467Trp) single nucleotide variant Hearing impairment [RCV001375191]|not provided [RCV000885475] Chr11:17511916 [GRCh38]
Chr11:17533463 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1946C>A (p.Ala649Glu) single nucleotide variant not provided [RCV000977186] Chr11:17509423 [GRCh38]
Chr11:17530970 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2381-10C>T single nucleotide variant Usher syndrome type 1C [RCV001276290]|not provided [RCV000944836] Chr11:17498281 [GRCh38]
Chr11:17519828 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.1413+1G>A single nucleotide variant not provided [RCV000944847] Chr11:17511901 [GRCh38]
Chr11:17533448 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.324T>C (p.Phe108=) single nucleotide variant Usher syndrome type 1C [RCV001276298]|not provided [RCV000941412] Chr11:17531217 [GRCh38]
Chr11:17552764 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1101A>G (p.Glu367=) single nucleotide variant Usher syndrome type 1C [RCV001276294]|not provided [RCV000978855] Chr11:17520979 [GRCh38]
Chr11:17542526 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.496+8A>G single nucleotide variant not provided [RCV000939928] Chr11:17527215 [GRCh38]
Chr11:17548762 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.408G>T (p.Arg136=) single nucleotide variant not provided [RCV000945179] Chr11:17527311 [GRCh38]
Chr11:17548858 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.135C>T (p.Asp45=) single nucleotide variant Usher syndrome type 1C [RCV001276300]|not provided [RCV000917428] Chr11:17531512 [GRCh38]
Chr11:17553059 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2491-1G>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV000770884] Chr11:17496814 [GRCh38]
Chr11:17518361 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.1134G>A (p.Trp378Ter) single nucleotide variant not provided [RCV000793534] Chr11:17520946 [GRCh38]
Chr11:17542493 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.760-66T>C single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538061]|Usher syndrome type 1C [RCV001538060]|not provided [RCV000838491] Chr11:17523544 [GRCh38]
Chr11:17545091 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2491-165C>A single nucleotide variant not provided [RCV000838523] Chr11:17496978 [GRCh38]
Chr11:17518525 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.760-116G>A single nucleotide variant not provided [RCV000838525] Chr11:17523594 [GRCh38]
Chr11:17545141 [GRCh37]
Chr11:11p15.1
benign
NC_000011.10:g.17494423G>A single nucleotide variant not provided [RCV000829571] Chr11:17515970 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2656-260A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537980]|Usher syndrome type 1C [RCV001537979]|not provided [RCV000826647] Chr11:17494636 [GRCh38]
Chr11:17516183 [GRCh37]
Chr11:11p15.1
benign
NC_000011.10:g.17533369C>A single nucleotide variant not provided [RCV000835203] Chr11:17554916 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.759+294C>T single nucleotide variant not provided [RCV000831721] Chr11:17524157 [GRCh38]
Chr11:17545704 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1211-1418G>A single nucleotide variant not provided [RCV000838492] Chr11:17517708 [GRCh38]
Chr11:17539255 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2184+229C>T single nucleotide variant not provided [RCV000838493] Chr11:17504418 [GRCh38]
Chr11:17525965 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2281-113A>G single nucleotide variant not provided [RCV000838494] Chr11:17501263 [GRCh38]
Chr11:17522810 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2547-183C>G single nucleotide variant not provided [RCV000838495] Chr11:17495860 [GRCh38]
Chr11:17517407 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.36+214C>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537960]|Usher syndrome type 1C [RCV001537959]|not provided [RCV000838519] Chr11:17544058 [GRCh38]
Chr11:17565605 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-243A>G single nucleotide variant not provided [RCV000838520] Chr11:17533565 [GRCh38]
Chr11:17555112 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1858C>T (p.Arg620Cys) single nucleotide variant not provided [RCV000835046]|not specified [RCV001002461] Chr11:17509511 [GRCh38]
Chr11:17531058 [GRCh37]
Chr11:11p15.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_153676.4(USH1C):c.2656-106T>C single nucleotide variant not provided [RCV000835159] Chr11:17494482 [GRCh38]
Chr11:17516029 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.759+272A>G single nucleotide variant not provided [RCV000831720] Chr11:17524179 [GRCh38]
Chr11:17545726 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1019+52G>A single nucleotide variant not provided [RCV000835841] Chr11:17522732 [GRCh38]
Chr11:17544279 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2004C>A (p.Pro668=) single nucleotide variant not provided [RCV000903646]|not specified [RCV000825846] Chr11:17509365 [GRCh38]
Chr11:17530912 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.1767C>T (p.Ser589=) single nucleotide variant not specified [RCV000825847] Chr11:17509602 [GRCh38]
Chr11:17531149 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2000C>T (p.Pro667Leu) single nucleotide variant not provided [RCV002249534]|not specified [RCV000826070] Chr11:17509369 [GRCh38]
Chr11:17530916 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.1(chr11:16775884-18418719)x3 copy number gain not provided [RCV000848590] Chr11:16775884..18418719 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2280+29C>T single nucleotide variant not provided [RCV000837263] Chr11:17501453 [GRCh38]
Chr11:17523000 [GRCh37]
Chr11:11p15.1
benign
NC_000011.10:g.17510555C>T single nucleotide variant not provided [RCV000829568] Chr11:17532102 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1531-64C>A single nucleotide variant not provided [RCV000829569] Chr11:17509902 [GRCh38]
Chr11:17531449 [GRCh37]
Chr11:11p15.1
benign
NC_000011.10:g.17533367G>C single nucleotide variant not provided [RCV000829562] Chr11:17554914 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1086-45A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538055]|Usher syndrome type 1C [RCV001538054]|not provided [RCV000829565] Chr11:17521039 [GRCh38]
Chr11:17542586 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1086-42G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538053]|Usher syndrome type 1C [RCV001538052]|not provided [RCV000829566] Chr11:17521036 [GRCh38]
Chr11:17542583 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2226+197G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538015]|Usher syndrome type 1C [RCV001538014]|not provided [RCV000829570] Chr11:17501742 [GRCh38]
Chr11:17523289 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.820-59C>T single nucleotide variant not provided [RCV000837048] Chr11:17523326 [GRCh38]
Chr11:17544873 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2609G>A (p.Arg870His) single nucleotide variant not provided [RCV000942837] Chr11:17495615 [GRCh38]
Chr11:17517162 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.497-6C>T single nucleotide variant not provided [RCV000978699] Chr11:17527046 [GRCh38]
Chr11:17548593 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1547C>T (p.Pro516Leu) single nucleotide variant not provided [RCV000978861] Chr11:17509822 [GRCh38]
Chr11:17531369 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.18C>A (p.Ala6=) single nucleotide variant not provided [RCV000980215] Chr11:17544290 [GRCh38]
Chr11:17565837 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1211-1125G>T single nucleotide variant not provided [RCV000819367] Chr11:17517415 [GRCh38]
Chr11:17538962 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.966G>T (p.Arg322=) single nucleotide variant not provided [RCV000895737] Chr11:17522837 [GRCh38]
Chr11:17544384 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.675-296A>G single nucleotide variant not provided [RCV000826646] Chr11:17524831 [GRCh38]
Chr11:17546378 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.-183T>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537988]|Usher syndrome type 1C [RCV001537987]|not provided [RCV000829560] Chr11:17544490 [GRCh38]
Chr11:17566037 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-61A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537958]|Usher syndrome type 1C [RCV001537957]|not provided [RCV000829561] Chr11:17533383 [GRCh38]
Chr11:17554930 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1086-108A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538057]|Usher syndrome type 1C [RCV001538056]|not provided [RCV000829564] Chr11:17521102 [GRCh38]
Chr11:17542649 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1261-34C>T single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001538049]|Usher syndrome type 1C [RCV001538048]|not provided [RCV000829567] Chr11:17512088 [GRCh38]
Chr11:17533635 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.496+66G>T single nucleotide variant not provided [RCV000838521] Chr11:17527157 [GRCh38]
Chr11:17548704 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2547-159_2547-158del deletion not provided [RCV000838522] Chr11:17495835..17495836 [GRCh38]
Chr11:17517382..17517383 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1287G>A (p.Lys429=) single nucleotide variant not provided [RCV000979381] Chr11:17512028 [GRCh38]
Chr11:17533575 [GRCh37]
Chr11:11p15.1
likely benign
NC_000011.10:g.17527190C= single nucleotide variant not provided [RCV000829563] Chr11:17548737 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.191del (p.Pro64fs) deletion not provided [RCV001054326] Chr11:17531456 [GRCh38]
Chr11:17553003 [GRCh37]
Chr11:11p15.1
pathogenic
GRCh37/hg19 11p15.2-14.1(chr11:13970757-27565888)x3 copy number gain not provided [RCV001006388] Chr11:13970757..27565888 [GRCh37]
Chr11:11p15.2-14.1
pathogenic
GRCh37/hg19 11p15.1(chr11:16436272-18064677)x3 copy number gain not provided [RCV000848487] Chr11:16436272..18064677 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.1(chr11:17468457-17543203)x1 copy number loss not provided [RCV000846181] Chr11:17468457..17543203 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.952C>A (p.Leu318Ile) single nucleotide variant Usher syndrome type 1C [RCV001828668]|not provided [RCV001208276] Chr11:17522851 [GRCh38]
Chr11:17544398 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2539G>A (p.Asp847Asn) single nucleotide variant Usher syndrome type 1C [RCV001828773]|not provided [RCV001222459] Chr11:17496765 [GRCh38]
Chr11:17518312 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.870T>A (p.Ala290=) single nucleotide variant Usher syndrome type 1C [RCV001834120]|not provided [RCV001240430] Chr11:17523217 [GRCh38]
Chr11:17544764 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.901C>T (p.Arg301Trp) single nucleotide variant Usher syndrome type 1C [RCV001835344]|not provided [RCV001248688] Chr11:17522902 [GRCh38]
Chr11:17544449 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1039C>G (p.Gln347Glu) single nucleotide variant not provided [RCV001234871] Chr11:17521392 [GRCh38]
Chr11:17542939 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.407G>A (p.Arg136Gln) single nucleotide variant Usher syndrome type 1C [RCV001828978]|not provided [RCV001241479]|not specified [RCV001449780] Chr11:17527312 [GRCh38]
Chr11:17548859 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.820-2A>T single nucleotide variant not provided [RCV001218304] Chr11:17523269 [GRCh38]
Chr11:17544816 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.387+1G>C single nucleotide variant not provided [RCV001226761] Chr11:17531153 [GRCh38]
Chr11:17552700 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.121G>A (p.Val41Met) single nucleotide variant Usher syndrome type 1C [RCV001833757]|not provided [RCV001664744]|not specified [RCV001195265] Chr11:17531526 [GRCh38]
Chr11:17553073 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.409A>G (p.Ile137Val) single nucleotide variant Usher syndrome type 1C [RCV001833991]|not provided [RCV001230230] Chr11:17527310 [GRCh38]
Chr11:17548857 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1175G>C single nucleotide variant Usher syndrome type 1C [RCV001105205] Chr11:17517465 [GRCh38]
Chr11:17539012 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.875C>G (p.Ala292Gly) single nucleotide variant Usher syndrome type 1C [RCV001108556] Chr11:17523212 [GRCh38]
Chr11:17544759 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.-109A>T single nucleotide variant Usher syndrome type 1C [RCV001108640] Chr11:17544416 [GRCh38]
Chr11:17565963 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.580-2A>T single nucleotide variant Hearing impairment [RCV001375345]|Usher syndrome type 2 [RCV001199565]|not provided [RCV001268623] Chr11:17526443 [GRCh38]
Chr11:17547990 [GRCh37]
Chr11:11p15.1
pathogenic|likely pathogenic
NM_153676.4(USH1C):c.*131G>C single nucleotide variant Usher syndrome type 1C [RCV001106251] Chr11:17494201 [GRCh38]
Chr11:17515748 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.923G>A (p.Arg308Gln) single nucleotide variant Usher syndrome type 1C [RCV001106341]|not provided [RCV001374152] Chr11:17522880 [GRCh38]
Chr11:17544427 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1019+173G>A single nucleotide variant not provided [RCV001564296] Chr11:17522611 [GRCh38]
Chr11:17544158 [GRCh37]
Chr11:11p15.1
likely benign
Single allele single nucleotide variant not provided [RCV001569427] Chr11:17544513 [GRCh38]
Chr11:17566060 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.674+155G>T single nucleotide variant not provided [RCV001551343] Chr11:17526192 [GRCh38]
Chr11:17547739 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.37-41T>G single nucleotide variant not provided [RCV001551575] Chr11:17533363 [GRCh38]
Chr11:17554910 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.105-148C>T single nucleotide variant not provided [RCV001555065] Chr11:17531690 [GRCh38]
Chr11:17553237 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2014-305G>C single nucleotide variant not provided [RCV001560806] Chr11:17506254 [GRCh38]
Chr11:17527801 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1019+51C>T single nucleotide variant not provided [RCV001560856] Chr11:17522733 [GRCh38]
Chr11:17544280 [GRCh37]
Chr11:11p15.1
likely benign
Single allele duplication not provided [RCV001637339] Chr11:17544749..17544750 [GRCh38]
Chr11:17566296..17566297 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.674+190A>G single nucleotide variant not provided [RCV001681937] Chr11:17526157 [GRCh38]
Chr11:17547704 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2655+180C>A single nucleotide variant not provided [RCV001650123] Chr11:17495389 [GRCh38]
Chr11:17516936 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-44G>T single nucleotide variant not provided [RCV001589718] Chr11:17533366 [GRCh38]
Chr11:17554913 [GRCh37]
Chr11:11p15.1
likely benign
Single allele duplication not provided [RCV001672190] Chr11:17544749..17544750 [GRCh38]
Chr11:17566296..17566297 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.104+295T>A single nucleotide variant not provided [RCV001577966] Chr11:17532960 [GRCh38]
Chr11:17554507 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.580-43C>T single nucleotide variant not provided [RCV001559119] Chr11:17526484 [GRCh38]
Chr11:17548031 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1596C>T (p.Phe532=) single nucleotide variant not provided [RCV001701232] Chr11:17509773 [GRCh38]
Chr11:17531320 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2184+47G>A single nucleotide variant not provided [RCV001566632] Chr11:17504600 [GRCh38]
Chr11:17526147 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.37-49_37-48insTT insertion not provided [RCV001673250] Chr11:17533370..17533371 [GRCh38]
Chr11:17554917..17554918 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1781C>T (p.Pro594Leu) single nucleotide variant not provided [RCV000944338] Chr11:17509588 [GRCh38]
Chr11:17531135 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1880A>G (p.Glu627Gly) single nucleotide variant not provided [RCV000931587] Chr11:17509489 [GRCh38]
Chr11:17531036 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1899T>C (p.His633=) single nucleotide variant not provided [RCV000919092] Chr11:17509470 [GRCh38]
Chr11:17531017 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1362G>A (p.Glu454=) single nucleotide variant not provided [RCV000932432] Chr11:17511953 [GRCh38]
Chr11:17533500 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1419T>C (p.Ser473=) single nucleotide variant not provided [RCV000909887] Chr11:17510516 [GRCh38]
Chr11:17532063 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2655G>A (p.Thr885=) single nucleotide variant not provided [RCV000931115] Chr11:17495569 [GRCh38]
Chr11:17517116 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.901C>A (p.Arg301=) single nucleotide variant not provided [RCV000975695] Chr11:17522902 [GRCh38]
Chr11:17544449 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1353A>G (p.Lys451=) single nucleotide variant not provided [RCV000975627] Chr11:17511962 [GRCh38]
Chr11:17533509 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.255G>A (p.Leu85=) single nucleotide variant not provided [RCV000928583] Chr11:17531286 [GRCh38]
Chr11:17552833 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.792C>T (p.Val264=) single nucleotide variant not provided [RCV000929866] Chr11:17523446 [GRCh38]
Chr11:17544993 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.570G>A (p.Ser190=) single nucleotide variant Usher syndrome type 1C [RCV001105299]|not provided [RCV000908705] Chr11:17526762 [GRCh38]
Chr11:17548309 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.497-10T>C single nucleotide variant not provided [RCV000931976] Chr11:17527050 [GRCh38]
Chr11:17548597 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2696G>T (p.Arg899Leu) single nucleotide variant not provided [RCV000910219] Chr11:17494336 [GRCh38]
Chr11:17515883 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1457T>C (p.Ile486Thr) single nucleotide variant not provided [RCV000977179] Chr11:17510478 [GRCh38]
Chr11:17532025 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.387+10C>T single nucleotide variant not provided [RCV000918259] Chr11:17531144 [GRCh38]
Chr11:17552691 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1591C>T (p.Arg531Cys) single nucleotide variant not provided [RCV001766993] Chr11:17509778 [GRCh38]
Chr11:17531325 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1592G>A (p.Arg531His) single nucleotide variant not provided [RCV000930840] Chr11:17509777 [GRCh38]
Chr11:17531324 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1602C>T (p.Gly534=) single nucleotide variant not provided [RCV000910984] Chr11:17509767 [GRCh38]
Chr11:17531314 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.822T>A (p.Ala274=) single nucleotide variant Usher syndrome type 1C [RCV001827429]|not provided [RCV001066652] Chr11:17523265 [GRCh38]
Chr11:17544812 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.36+2T>A single nucleotide variant not provided [RCV001172046] Chr11:17544270 [GRCh38]
Chr11:17565817 [GRCh37]
Chr11:11p15.1
likely pathogenic
NM_153676.4(USH1C):c.*241C>G single nucleotide variant Usher syndrome type 1C [RCV001106250] Chr11:17494091 [GRCh38]
Chr11:17515638 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.200C>T (p.Pro67Leu) single nucleotide variant Usher syndrome type 1C [RCV001106429] Chr11:17531447 [GRCh38]
Chr11:17552994 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2401G>A (p.Glu801Lys) single nucleotide variant Usher syndrome type 1C [RCV001829941]|not provided [RCV001244895] Chr11:17498251 [GRCh38]
Chr11:17519798 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2401G>T (p.Glu801Ter) single nucleotide variant not provided [RCV001232033] Chr11:17498251 [GRCh38]
Chr11:17519798 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.2310C>T (p.Gly770=) single nucleotide variant Usher syndrome type 1C [RCV001830038]|not provided [RCV001248420] Chr11:17501121 [GRCh38]
Chr11:17522668 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1151C>T single nucleotide variant not provided [RCV001208555] Chr11:17517441 [GRCh38]
Chr11:17538988 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2490+6A>C single nucleotide variant Usher syndrome type 1C [RCV001108478] Chr11:17498156 [GRCh38]
Chr11:17519703 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.361G>A (p.Gly121Ser) single nucleotide variant Usher syndrome type 1C [RCV001835181]|not provided [RCV001243721] Chr11:17531180 [GRCh38]
Chr11:17552727 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2375G>C (p.Arg792Pro) single nucleotide variant not provided [RCV001224966] Chr11:17501056 [GRCh38]
Chr11:17522603 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2253G>A (p.Lys751=) single nucleotide variant Usher syndrome type 1C [RCV001105203]|not provided [RCV001416724] Chr11:17501509 [GRCh38]
Chr11:17523056 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.231G>T (p.Leu77=) single nucleotide variant not provided [RCV000913770] Chr11:17531416 [GRCh38]
Chr11:17552963 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.820-9T>C single nucleotide variant not provided [RCV000934192] Chr11:17523276 [GRCh38]
Chr11:17544823 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2547-46G>A single nucleotide variant not provided [RCV001577143] Chr11:17495723 [GRCh38]
Chr11:17517270 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2134-22dup duplication Usher syndrome type 1C [RCV001832835]|not provided [RCV001656787] Chr11:17504707..17504708 [GRCh38]
Chr11:17526254..17526255 [GRCh37]
Chr11:11p15.1
benign
Single allele single nucleotide variant not provided [RCV001656968] Chr11:17544747 [GRCh38]
Chr11:17566294 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.820-26G>A single nucleotide variant not provided [RCV001557476] Chr11:17523293 [GRCh38]
Chr11:17544840 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1530+273C>G single nucleotide variant not provided [RCV001557500] Chr11:17510132 [GRCh38]
Chr11:17531679 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2490+174G>A single nucleotide variant not provided [RCV001558281] Chr11:17497988 [GRCh38]
Chr11:17519535 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.388-312G>T single nucleotide variant not provided [RCV001558950] Chr11:17527643 [GRCh38]
Chr11:17549190 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.675-191T>G single nucleotide variant not provided [RCV001717698] Chr11:17524726 [GRCh38]
Chr11:17546273 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.-31G>T single nucleotide variant not provided [RCV001559542] Chr11:17544338 [GRCh38]
Chr11:17565885 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.579+92C>T single nucleotide variant not provided [RCV001644050] Chr11:17526661 [GRCh38]
Chr11:17548208 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2184+254C>G single nucleotide variant not provided [RCV001678176] Chr11:17504393 [GRCh38]
Chr11:17525940 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-150C>A single nucleotide variant not provided [RCV001560179] Chr11:17533472 [GRCh38]
Chr11:17555019 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2655+33T>A single nucleotide variant not provided [RCV001560225] Chr11:17495536 [GRCh38]
Chr11:17517083 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.580-27G>T single nucleotide variant not provided [RCV001568821] Chr11:17526468 [GRCh38]
Chr11:17548015 [GRCh37]
Chr11:11p15.1
likely benign
Single allele duplication not provided [RCV001561075] Chr11:17544749..17544750 [GRCh38]
Chr11:17566296..17566297 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.522-44G>A single nucleotide variant not provided [RCV001561445] Chr11:17526854 [GRCh38]
Chr11:17548401 [GRCh37]
Chr11:11p15.1
likely benign
GRCh37/hg19 11p15.5-13(chr11:235934-33826995)x3 copy number gain not provided [RCV001006372] Chr11:235934..33826995 [GRCh37]
Chr11:11p15.5-13
pathogenic
NM_153676.4(USH1C):c.1530+121T>A single nucleotide variant not provided [RCV001674476] Chr11:17510284 [GRCh38]
Chr11:17531831 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1020-245C>G single nucleotide variant not provided [RCV001717669] Chr11:17521656 [GRCh38]
Chr11:17543203 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-44_37-43dup duplication not provided [RCV001597346] Chr11:17533363..17533364 [GRCh38]
Chr11:17554910..17554911 [GRCh37]
Chr11:11p15.1
benign
Single allele single nucleotide variant not provided [RCV001676360] Chr11:17544434 [GRCh38]
Chr11:17565981 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1260+282G>A single nucleotide variant not provided [RCV001581960] Chr11:17515959 [GRCh38]
Chr11:17537506 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.675-96C>T single nucleotide variant not provided [RCV001595449] Chr11:17524631 [GRCh38]
Chr11:17546178 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1211-935G>A single nucleotide variant not provided [RCV001658675] Chr11:17517225 [GRCh38]
Chr11:17538772 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2656-115G>A single nucleotide variant not provided [RCV001617532] Chr11:17494491 [GRCh38]
Chr11:17516038 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1211-1375A>G single nucleotide variant not provided [RCV001621636] Chr11:17517665 [GRCh38]
Chr11:17539212 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1019+227C>T single nucleotide variant not provided [RCV001596095] Chr11:17522557 [GRCh38]
Chr11:17544104 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2491-41C>T single nucleotide variant not provided [RCV001591453] Chr11:17496854 [GRCh38]
Chr11:17518401 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1085+26C>T single nucleotide variant not provided [RCV001591511] Chr11:17521320 [GRCh38]
Chr11:17542867 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1019+222C>G single nucleotide variant not provided [RCV001638574] Chr11:17522562 [GRCh38]
Chr11:17544109 [GRCh37]
Chr11:11p15.1
benign
GRCh37/hg19 11p15.3-13(chr11:11053978-34732891)x3 copy number gain not provided [RCV001006387] Chr11:11053978..34732891 [GRCh37]
Chr11:11p15.3-13
pathogenic
NM_153676.4(USH1C):c.2437T>G (p.Tyr813Asp) single nucleotide variant Usher syndrome type 1C [RCV001103298] Chr11:17498215 [GRCh38]
Chr11:17519762 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*427T>C single nucleotide variant Usher syndrome type 1C [RCV001105128] Chr11:17493905 [GRCh38]
Chr11:17515452 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1106G>A single nucleotide variant Usher syndrome type 1C [RCV001105204] Chr11:17517396 [GRCh38]
Chr11:17538943 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.659G>A (p.Arg220Gln) single nucleotide variant not provided [RCV001053962] Chr11:17526362 [GRCh38]
Chr11:17547909 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1064G>T (p.Arg355Ile) single nucleotide variant Usher syndrome type 1C [RCV001106339] Chr11:17521367 [GRCh38]
Chr11:17542914 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2362G>A (p.Gly788Arg) single nucleotide variant Usher syndrome type 1C [RCV001103300]|not provided [RCV001339115] Chr11:17501069 [GRCh38]
Chr11:17522616 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2377C>T (p.His793Tyr) single nucleotide variant Usher syndrome type 1C [RCV001833756]|not provided [RCV001586036]|not specified [RCV001195262] Chr11:17501054 [GRCh38]
Chr11:17522601 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.-60T>G single nucleotide variant Usher syndrome type 1C [RCV001108639] Chr11:17544367 [GRCh38]
Chr11:17565914 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.579+116T>C single nucleotide variant not provided [RCV001669870] Chr11:17526637 [GRCh38]
Chr11:17548184 [GRCh37]
Chr11:11p15.1
benign
Single allele single nucleotide variant not provided [RCV001585321] Chr11:17544758 [GRCh38]
Chr11:17566305 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.759+144A>G single nucleotide variant not provided [RCV001652813] Chr11:17524307 [GRCh38]
Chr11:17545854 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.580-145A>G single nucleotide variant not provided [RCV001684367] Chr11:17526586 [GRCh38]
Chr11:17548133 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1519G>A (p.Glu507Lys) single nucleotide variant not provided [RCV001541831] Chr11:17510416 [GRCh38]
Chr11:17531963 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1020-42C>T single nucleotide variant not provided [RCV001665876] Chr11:17521453 [GRCh38]
Chr11:17543000 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1211-1256G>C single nucleotide variant not provided [RCV001585383] Chr11:17517546 [GRCh38]
Chr11:17539093 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.1211-1249C>T single nucleotide variant not provided [RCV001649179] Chr11:17517539 [GRCh38]
Chr11:17539086 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.37-168G>A single nucleotide variant not provided [RCV001590035] Chr11:17533490 [GRCh38]
Chr11:17555037 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2134-11T>C single nucleotide variant Usher syndrome type 1C [RCV001832734]|not provided [RCV001539390] Chr11:17504708 [GRCh38]
Chr11:17526255 [GRCh37]
Chr11:11p15.1
benign|likely benign
NM_153676.4(USH1C):c.1211-211C>T single nucleotide variant not provided [RCV001540379] Chr11:17516501 [GRCh38]
Chr11:17538048 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.1085+5G>C single nucleotide variant not provided [RCV001233073] Chr11:17521341 [GRCh38]
Chr11:17542888 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.263del (p.Val88fs) deletion Usher syndrome type 2 [RCV001199563] Chr11:17531278 [GRCh38]
Chr11:17552825 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.2225T>C (p.Met742Thr) single nucleotide variant Usher syndrome type 1C [RCV001833871]|not provided [RCV001213752] Chr11:17501940 [GRCh38]
Chr11:17523487 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1132_1133del (p.Trp378fs) deletion not provided [RCV001219009] Chr11:17520947..17520948 [GRCh38]
Chr11:17542494..17542495 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.1070G>A (p.Arg357Gln) single nucleotide variant Usher syndrome type 1C [RCV001827275]|not provided [RCV001044717] Chr11:17521361 [GRCh38]
Chr11:17542908 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1053G>C (p.Glu351Asp) single nucleotide variant Usher syndrome type 1 [RCV001197678] Chr11:17521378 [GRCh38]
Chr11:17542925 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.628A>T (p.Lys210Ter) single nucleotide variant not provided [RCV001205881] Chr11:17526393 [GRCh38]
Chr11:17547940 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.1944G>T (p.Glu648Asp) single nucleotide variant not specified [RCV001195264] Chr11:17509425 [GRCh38]
Chr11:17530972 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1838C>T (p.Thr613Ile) single nucleotide variant not specified [RCV001195263] Chr11:17509531 [GRCh38]
Chr11:17531078 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*117C>G single nucleotide variant Usher syndrome type 1C [RCV001106252] Chr11:17494215 [GRCh38]
Chr11:17515762 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.*110C>G single nucleotide variant Usher syndrome type 1C [RCV001106253] Chr11:17494222 [GRCh38]
Chr11:17515769 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1085+7A>G single nucleotide variant Usher syndrome type 1C [RCV001106338]|not provided [RCV002069752] Chr11:17521339 [GRCh38]
Chr11:17542886 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.909G>T (p.Arg303=) single nucleotide variant not specified [RCV001195475] Chr11:17522894 [GRCh38]
Chr11:17544441 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.907C>T (p.Arg303Trp) single nucleotide variant Usher syndrome type 1C [RCV001832391]|not provided [RCV001038731] Chr11:17522896 [GRCh38]
Chr11:17544443 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2541T>C (p.Asp847=) single nucleotide variant Usher syndrome type 1C [RCV001108477] Chr11:17496763 [GRCh38]
Chr11:17518310 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.569C>G (p.Ser190Trp) single nucleotide variant Usher syndrome type 1C [RCV001273252]|not provided [RCV001041266] Chr11:17526763 [GRCh38]
Chr11:17548310 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1112A>G single nucleotide variant Usher syndrome type 1C [RCV001833636]|not provided [RCV001065291] Chr11:17517402 [GRCh38]
Chr11:17538949 [GRCh37]
Chr11:11p15.1
uncertain significance
GRCh37/hg19 11p15.1(chr11:17461542-17773192)x3 copy number gain not provided [RCV001259579] Chr11:17461542..17773192 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.530A>G (p.Asp177Gly) single nucleotide variant Usher syndrome type 1C [RCV001830212]|not provided [RCV001304715] Chr11:17526802 [GRCh38]
Chr11:17548349 [GRCh37]
Chr11:11p15.1
uncertain significance
NC_000011.9:g.(?_17552691)_(19213995_?)dup duplication Progressive myoclonic epilepsy type 7 [RCV001295201] Chr11:17552691..19213995 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1167C>T single nucleotide variant not provided [RCV001908212] Chr11:17517457 [GRCh38]
Chr11:17539004 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.579+61G>A single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537948]|Usher syndrome type 1C [RCV001537947]|not provided [RCV001539299] Chr11:17526692 [GRCh38]
Chr11:17548239 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.521+56A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537950]|Usher syndrome type 1C [RCV001537949]|not provided [RCV001712985] Chr11:17526960 [GRCh38]
Chr11:17548507 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2546+125A>G single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001537984]|Usher syndrome type 1C [RCV001537983]|not provided [RCV001713113] Chr11:17496633 [GRCh38]
Chr11:17518180 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.675-133G>A single nucleotide variant not provided [RCV001539705] Chr11:17524668 [GRCh38]
Chr11:17546215 [GRCh37]
Chr11:11p15.1
benign
NM_153676.4(USH1C):c.2270G>A (p.Arg757His) single nucleotide variant Usher syndrome type 1C [RCV001280391] Chr11:17501492 [GRCh38]
Chr11:17523039 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1177G>T single nucleotide variant Usher syndrome type 1C [RCV001280394] Chr11:17517467 [GRCh38]
Chr11:17539014 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.37-44_37-42dup duplication not provided [RCV001572375] Chr11:17533363..17533364 [GRCh38]
Chr11:17554910..17554911 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.2280+23G>A single nucleotide variant not provided [RCV001581428] Chr11:17501459 [GRCh38]
Chr11:17523006 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.127G>T (p.Val43Leu) single nucleotide variant not provided [RCV001341656] Chr11:17531520 [GRCh38]
Chr11:17553067 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.238C>T (p.Arg80Trp) single nucleotide variant Usher syndrome type 1C [RCV001830236]|not provided [RCV001307008] Chr11:17531409 [GRCh38]
Chr11:17552956 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2360G>C (p.Arg787Pro) single nucleotide variant not provided [RCV001317403] Chr11:17501071 [GRCh38]
Chr11:17522618 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2321C>T (p.Ser774Phe) single nucleotide variant Usher syndrome type 1C [RCV001280390] Chr11:17501110 [GRCh38]
Chr11:17522657 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1211-1140G>A single nucleotide variant Usher syndrome type 1C [RCV001280393] Chr11:17517430 [GRCh38]
Chr11:17538977 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.776T>G (p.Val259Gly) single nucleotide variant Usher syndrome type 1C [RCV001280397] Chr11:17523462 [GRCh38]
Chr11:17545009 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.412A>G (p.Asn138Asp) single nucleotide variant Usher syndrome type 1C [RCV001280403] Chr11:17527307 [GRCh38]
Chr11:17548854 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.405C>G (p.Val135=) single nucleotide variant Usher syndrome type 1C [RCV001280404]|not provided [RCV002069490] Chr11:17527314 [GRCh38]
Chr11:17548861 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.2374C>T (p.Arg792Trp) single nucleotide variant Usher syndrome type 1C [RCV001280388] Chr11:17501057 [GRCh38]
Chr11:17522604 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2327T>A (p.Ile776Asn) single nucleotide variant Usher syndrome type 1C [RCV001280389] Chr11:17501104 [GRCh38]
Chr11:17522651 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.864T>G (p.Ile288Met) single nucleotide variant Usher syndrome type 1C [RCV001280396]|not provided [RCV001316883] Chr11:17523223 [GRCh38]
Chr11:17544770 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.501C>T (p.Ile167=) single nucleotide variant Usher syndrome type 1C [RCV001280401]|not provided [RCV001475656] Chr11:17527036 [GRCh38]
Chr11:17548583 [GRCh37]
Chr11:11p15.1
likely benign|uncertain significance
NM_153676.4(USH1C):c.341T>C (p.Ile114Thr) single nucleotide variant Usher syndrome type 1C [RCV001280405]|not provided [RCV001773586] Chr11:17531200 [GRCh38]
Chr11:17552747 [GRCh37]
Chr11:11p15.1
uncertain significance
NC_000011.9:g.(?_17555235)_(17667491_?)dup duplication not provided [RCV001295949] Chr11:17555235..17667491 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.1910C>G (p.Thr637Ser) single nucleotide variant Autosomal recessive nonsyndromic hearing loss 18A [RCV001331814] Chr11:17509459 [GRCh38]
Chr11:17531006 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2486G>A (p.Gly829Asp) single nucleotide variant not provided [RCV001318503] Chr11:17498166 [GRCh38]
Chr11:17519713 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.844C>T (p.Arg282Cys) single nucleotide variant Usher syndrome type 1C [RCV001835406]|not provided [RCV001297278] Chr11:17523243 [GRCh38]
Chr11:17544790 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2371G>A (p.Glu791Lys) single nucleotide variant Usher syndrome type 1C [RCV001835594]|not provided [RCV001318893] Chr11:17501060 [GRCh38]
Chr11:17522607 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.502G>A (p.Gly168Ser) single nucleotide variant Usher syndrome type 1C [RCV001835430]|not provided [RCV001300021] Chr11:17527035 [GRCh38]
Chr11:17548582 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.658C>G (p.Arg220Gly) single nucleotide variant Hearing impairment [RCV001375094] Chr11:17526363 [GRCh38]
Chr11:17547910 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.424A>G (p.Ile142Val) single nucleotide variant Hearing impairment [RCV001375305] Chr11:17527295 [GRCh38]
Chr11:17548842 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2525del (p.Pro842fs) deletion not provided [RCV001356182] Chr11:17496779 [GRCh38]
Chr11:17518326 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2656-20C>T single nucleotide variant not provided [RCV001395871] Chr11:17494396 [GRCh38]
Chr11:17515943 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.522-9T>C single nucleotide variant not provided [RCV001397291] Chr11:17526819 [GRCh38]
Chr11:17548366 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.586C>T (p.Arg196Ter) single nucleotide variant not provided [RCV001383895] Chr11:17526435 [GRCh38]
Chr11:17547982 [GRCh37]
Chr11:11p15.1
pathogenic
NM_153676.4(USH1C):c.2232C>T (p.Thr744=) single nucleotide variant not provided [RCV001433794] Chr11:17501530 [GRCh38]
Chr11:17523077 [GRCh37]
Chr11:11p15.1
likely benign
NM_153676.4(USH1C):c.781G>A (p.Val261Ile) single nucleotide variant Usher syndrome type 1C [RCV001835539]|not provided [RCV001313325] Chr11:17523457 [GRCh38]
Chr11:17545004 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.2312G>T (p.Gly771Val) single nucleotide variant Usher syndrome type 1C [RCV001830140]|not provided [RCV001296903] Chr11:17501119 [GRCh38]
Chr11:17522666 [GRCh37]
Chr11:11p15.1
uncertain significance
NM_153676.4(USH1C):c.358G>A (p.Gly120Ser) single nucleot