MIR181D (microRNA 181d) - Rat Genome Database

Name: MIR181D
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR181D (microRNA 181d) Homo sapiens

Analyze

Symbol:

MIR181D

Name:

microRNA 181d

RGD ID:

1603765

HGNC Page

HGNC

Description:

Predicted to be involved in several processes, including SMAD protein signal transduction; long-term synaptic potentiation; and sensory perception of sound.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mir-181d; MIRN181D

RGD Orthologs

Mouse

Rat

Alliance Genes

More Info

more info ...

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	19	13,874,875 - 13,875,011 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	19	13,874,875 - 13,875,011 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	19	13,985,689 - 13,985,825 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	13,846,688 - 13,846,824 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	19	13,879,434 - 13,879,570 (+)	NCBI
Cytogenetic Map	19	p13.12	NCBI
HuRef	19	13,557,000 - 13,557,136 (+)	NCBI		HuRef
CHM1_1	19	13,986,385 - 13,986,521 (+)	NCBI		CHM1_1

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Experimental Liver Neoplasms (EXP)

Neoplasm Metastasis (EXP)

pancreatitis (EXP)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (EXP)

all-trans-retinoic acid (EXP)

arsenous acid (EXP)

benzo[a]pyrene (EXP)

Benzo[k]fluoranthene (EXP)

bleomycin A2 (ISO)

cadmium dichloride (EXP)

dexamethasone (ISO)

diarsenic trioxide (EXP)

endosulfan (ISO)

formaldehyde (EXP)

hydrogen peroxide (EXP)

lipopolysaccharide (ISO)

paracetamol (EXP,ISO)

progesterone (EXP)

sodium arsenite (EXP)

sodium fluoride (ISO)

tetraphene (EXP)

titanium dioxide (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to growth factor stimulus (ISO)

long-term synaptic potentiation (ISO)

sensory perception of sound (ISO)

SMAD protein signal transduction (ISO)

References

References - curated


1.	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:15965474	PMID:16381832	PMID:17604727	PMID:21037258	PMID:22207524	PMID:22570426	PMID:23034410	PMID:23993976	PMID:24103759	PMID:24573637	PMID:25336585	PMID:25535255
PMID:26646931	PMID:26939869	PMID:27057640	PMID:27380024	PMID:27447109	PMID:27572270	PMID:28185956	PMID:28286260	PMID:28381166	PMID:28389653	PMID:28731516	PMID:28749470
PMID:30024590	PMID:30031607	PMID:30628487	PMID:30915768	PMID:31352814	PMID:31413305	PMID:31524144	PMID:31696473

Genomics

Comparative Map Data

MIR181D
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	19	13,874,875 - 13,875,011 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	19	13,874,875 - 13,875,011 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	19	13,985,689 - 13,985,825 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	13,846,688 - 13,846,824 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	19	13,879,434 - 13,879,570 (+)	NCBI
Cytogenetic Map	19	p13.12	NCBI
HuRef	19	13,557,000 - 13,557,136 (+)	NCBI		HuRef
CHM1_1	19	13,986,385 - 13,986,521 (+)	NCBI		CHM1_1

Mir181d
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	84,905,345 - 84,905,416 (-)	NCBI	GRCm39		mm39
GRCm39 Ensembl	8	84,905,345 - 84,905,416 (-)	Ensembl
GRCm38	8	84,178,716 - 84,178,787 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	84,178,716 - 84,178,787 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	8	86,702,615 - 86,702,686 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	8	88,479,159 - 88,479,230 (-)	NCBI		Celera
Cytogenetic Map	8	C2	NCBI

Mir181d
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	19	23,983,706 - 23,983,788 (+)	NCBI
Rnor_6.0 Ensembl	19	25,290,051 - 25,290,133 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	19	25,290,051 - 25,290,133 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	19	36,267,151 - 36,267,233 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	19	23,532,249 - 23,532,331 (+)	NCBI		Celera
Cytogenetic Map	19	q11	NCBI

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
BCL2	hsa-miR-181d-5p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot//	Functional MTI	20162574
BCL2	hsa-miR-181d-5p	Mirtarbase	external_info	FACS//Immunohistochemistry//Luciferase reporter as	Functional MTI	22207524
MGMT	hsa-miR-181d-5p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot	Functional MTI	22570426
MGMT	hsa-miR-181d-5p	OncomiRDB	external_info	NA	NA	22570426
KRAS	hsa-miR-181d-5p	OncomiRDB	external_info	NA	NA	22207524
RASSF1	hsa-miR-181d-5p	OncomiRDB	external_info	NA	NA	21352471
CDX2	hsa-miR-181d-5p	OncomiRDB	external_info	NA	NA	19585654
TCL1A	hsa-miR-181d-5p	OncomiRDB	external_info	NA	NA	17178851
BCL2	hsa-miR-181d-3p	Tarbase	external_info	Reporter Gene	POSITIVE
BCL2	hsa-miR-181d-3p	Tarbase	external_info	Westernblit	POSITIVE
NLK	hsa-miR-181d-3p	Mirecords	external_info	NA	NA	19585654
NRDC	hsa-miR-181d-5p	Mirtarbase	external_info	CLASH	Functional MTI (Weak)	23622248

Predicted Targets

	Summary Value
Count of predictions:	35952
Count of gene targets:	14210
Count of transcripts:	29956
Interacting mature miRNAs:	hsa-miR-181d-3p, hsa-miR-181d-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	sensory system	adipose tissue	appendage	entire extraembryonic component
High
Medium									3		1	2
Low	59	21	58	12	123	14	46	46	385	23	97	139	5	5	14	1
Below cutoff	162	145	146	23	93	11	136	111	662	43	153	130	12	35	78	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_030179	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC020916	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AY785944	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM609469	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENST00000384853

RefSeq Status:

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p13 Ensembl	19	13,874,875 - 13,875,011 (+)	Ensembl

RefSeq Acc Id:

NR_030179

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	19	13,874,875 - 13,875,011 (+)	NCBI
GRCh37	19	13,985,689 - 13,985,825 (+)	RGD
Celera	19	13,879,434 - 13,879,570 (+)	RGD
HuRef	19	13,557,000 - 13,557,136 (+)	ENTREZGENE
CHM1_1	19	13,986,385 - 13,986,521 (+)	NCBI

Sequence:

show sequence

GTCCCCTCCCCTAGGCCACAGCCGAGGTCACAATCAACATTCATTGTTGTCGGTGGGTTGTGAG
GACTGAGGCCAGACCCACCGGGGGATGAATGTCACTGTGGCTGGGCCAGACACGGCTTAAGGGG
AATGGGGAC

hide sequence

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 19p13.2-q13.31(chr19:11227942-44626354)x3	copy number gain	See cases [RCV000133888]	Chr19:11227942..44626354 [GRCh38] Chr19:11338618..45129651 [GRCh37] Chr19:11199618..49821491 [NCBI36] Chr19:19p13.2-q13.31	pathogenic
GRCh38/hg38 19p13.13-13.12(chr19:13533925-15371089)x1	copy number loss	See cases [RCV000136502]	Chr19:13533925..15371089 [GRCh38] Chr19:13644739..15481900 [GRCh37] Chr19:13505739..15342900 [NCBI36] Chr19:19p13.13-13.12	pathogenic
GRCh38/hg38 19p13.2-13.12(chr19:12580427-14742673)x1	copy number loss	See cases [RCV000135937]	Chr19:12580427..14742673 [GRCh38] Chr19:12691241..14853485 [GRCh37] Chr19:12552241..14714485 [NCBI36] Chr19:19p13.2-13.12	pathogenic\|likely pathogenic
GRCh38/hg38 19p13.2-13.12(chr19:11525163-14155021)x1	copy number loss	See cases [RCV000136909]	Chr19:11525163..14155021 [GRCh38] Chr19:11635978..14265833 [GRCh37] Chr19:11496978..14126833 [NCBI36] Chr19:19p13.2-13.12	pathogenic
GRCh38/hg38 19p13.13-13.12(chr19:13533925-14258833)x1	copy number loss	See cases [RCV000051051]	Chr19:13533925..14258833 [GRCh38] Chr19:13644739..14369645 [GRCh37] Chr19:13505739..14230645 [NCBI36] Chr19:19p13.13-13.12	uncertain significance
GRCh38/hg38 19p13.2-13.12(chr19:10315258-14048994)x3	copy number gain	See cases [RCV000052909]	Chr19:10315258..14048994 [GRCh38] Chr19:10425934..14159806 [GRCh37] Chr19:10286934..14020806 [NCBI36] Chr19:19p13.2-13.12	pathogenic
GRCh38/hg38 19p13.2-13.12(chr19:12132052-14751798)x3	copy number gain	See cases [RCV000052910]	Chr19:12132052..14751798 [GRCh38] Chr19:12242867..14862610 [GRCh37] Chr19:12103867..14723610 [NCBI36] Chr19:19p13.2-13.12	pathogenic
GRCh38/hg38 19p13.2-13.12(chr19:11227942-14532135)x1	copy number loss	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053944]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053944]\|See cases [RCV000053944]	Chr19:11227942..14532135 [GRCh38] Chr19:11338618..14642947 [GRCh37] Chr19:11199618..14503947 [NCBI36] Chr19:19p13.2-13.12	pathogenic

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	HGNC:32089	AgrOrtholog
COSMIC	MIR181D	COSMIC
Ensembl Genes	ENSG00000207585	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000384853	ENTREZGENE
GTEx	ENSG00000207585	GTEx
HGNC ID	HGNC:32089	ENTREZGENE
Human Proteome Map	MIR181D	Human Proteome Map
miRBase	MI0003139	ENTREZGENE
NCBI Gene	574457	ENTREZGENE
PharmGKB	PA164722526	PharmGKB
RNAcentral	URS0000236310	RNACentral
	URS000075C355	RNACentral
	URS000075EF65	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - CTD