Gene: Gm24958 (predicted gene, 24958) Mus musculus |
|
Analyze |
|
Symbol: |
Gm24958 (Ensembl: Gm56314) |
Name: |
predicted gene, 24958 (Ensembl:predicted gene, 56314) |
RGD ID: |
15556632 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna (Ensembl: miRNA)
|
RefSeq Status: |
MODEL |
Previously known as: |
LOC115487911; small nucleolar RNA SNORD125 |
RGD Orthologs |
|
Alliance Genes |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 Ensembl - Mouse Genome Assembly GRCm39 Ensembl |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 11 | 4,988,211 - 4,988,307 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 11 | 4,988,204 - 4,988,307 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm39 Ensembl | 11 | 4,988,211 - 4,988,307 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 11 | 5,038,211 - 5,038,307 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 11 | 5,038,211 - 5,038,307 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 11 | A1 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
Comparative Map Data
Gm24958 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 11 | 4,988,211 - 4,988,307 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 11 | 4,988,204 - 4,988,307 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm39 Ensembl | 11 | 4,988,211 - 4,988,307 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 11 | 5,038,211 - 5,038,307 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 11 | 5,038,211 - 5,038,307 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 11 | A1 | NCBI | | | | |
|
SNORD125 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 22 | 29,333,163 - 29,333,258 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 22 | 29,333,163 - 29,333,258 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 22 | 29,729,152 - 29,729,247 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 22 | 28,059,152 - 28,059,247 (-) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 22 | 13,529,008 - 13,529,103 (-) | NCBI | | Celera | | | Cytogenetic Map | 22 | q12.2 | NCBI | | | | | HuRef | 22 | 12,693,391 - 12,693,486 (-) | NCBI | | HuRef | | | CHM1_1 | 22 | 29,688,552 - 29,688,647 (-) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 22 | 29,796,575 - 29,796,670 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
LOC120096836 (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 14 | 84,140,020 - 84,140,116 (+) | NCBI | | GRCr8 | | | mRatBN7.2 | 14 | 79,925,963 - 79,926,059 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 14 | 79,925,963 - 79,926,059 (+) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 Ensembl | 14 | 85,277,049 - 85,277,145 (+) | NCBI | Rnor6.0 | | rn6 | Rnor6.0 | Cytogenetic Map | 14 | q21 | NCBI | | | | |
|
LOC119866291 (Canis lupus familiaris - dog) |
Dog Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
Dog10K_Boxer_Tasha | 26 | 22,510,475 - 22,510,571 (-) | NCBI | | Dog10K_Boxer_Tasha | | | ROS_Cfam_1.0 | 26 | 23,012,769 - 23,012,865 (-) | NCBI | | ROS_Cfam_1.0 | | | UMICH_Zoey_3.1 | 26 | 22,721,932 - 22,722,028 (-) | NCBI | | UMICH_Zoey_3.1 | | | UNSW_CanFamBas_1.0 | 26 | 22,985,078 - 22,985,174 (-) | NCBI | | UNSW_CanFamBas_1.0 | | | UU_Cfam_GSD_1.0 | 26 | 23,050,095 - 23,050,191 (-) | NCBI | | UU_Cfam_GSD_1.0 | | |
|
miRNA Target Status
Predicted Target Of
Count of predictions: | 70 | Count of miRNA genes: | 65 | Interacting mature miRNAs: | 68 | Transcripts: | ENSMUST00000158009 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000158009 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 11 | 4,988,211 - 4,988,307 (+) | Ensembl | GRCm38.p6 Ensembl | 11 | 5,038,211 - 5,038,307 (+) | Ensembl |
|
RefSeq Acc Id: |
ENSMUST00020183401 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 11 | 4,988,204 - 4,988,307 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004937371 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 11 | 4,988,211 - 4,988,307 (+) | NCBI |
|
Sequence: |
AACCTTGGCAGCCCCTCTTGGTGATTCCTCCTCCTGAGTGGCTCCAATGATGAGCAAACTGAGC TTCTAAGAAGTTGACTGAATGGGCAGCTCTGCC
hide sequence
|
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2023-11-06 |
Gm24958 |
predicted gene, 24958 |
Gm56314 |
predicted gene, 56314 |
Symbol and/or name updated |
27372883 |
PROVISIONAL |
2022-10-27 |
Gm56314 |
predicted gene, 56314 |
Gm24958 |
predicted gene, 24958 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-07-02 |
Gm24958 |
predicted gene, 24958 |
LOC115487911 |
small nucleolar RNA SNORD125 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-19 |
LOC115487911 |
small nucleolar RNA SNORD125 |
Gm24958 |
predicted gene, 24958 |
Symbol and/or name change |
5135510 |
APPROVED |
|
|