Gm52780 (predicted gene, 52780) - Rat Genome Database

Name: Gm52780
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: Gm52780 (predicted gene, 52780) Mus musculus

Analyze

Symbol:

Gm52780

Name:

predicted gene, 52780

RGD ID:

15022430

MGI Page

MGI

Description:

Type:

ncrna

RefSeq Status:

MODEL

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	5	93,185,550 - 93,188,741 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm38	5	93,037,691 - 93,040,882 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
Cytogenetic Map	5	E2	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

References

Genomics

Variants

Variants in Gm52780
90 total Variants

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
11341716	Rvfs3_m	Rift Valley fever susceptibility 3 (mouse)					5	26441234	138455402	Mouse
4140990	Lgq6_m	late growth QTL 6 (mouse)			Not determined			32133234	100777931	Mouse
4141219	W10q16_m	weight 10 weeks QTL 16 (mouse)			Not determined			32133234	100777931	Mouse
1301524	Lmb2_m	lupus in MRL and B6 F2 cross (mouse)			Not determined		5	37581488	112465722	Mouse
11041665	Lmr24_m	leishmaniasis resistance 24 (mouse)					5	52694462	107321041	Mouse
11041899	Lmr24a_m	leishmaniasis resistance 24a (mouse)					5	52694462	107321041	Mouse
4142064	Tmc1m4_m	Tmc1 modifier 4 (mouse)			Not determined		5	54500177	127001072	Mouse
1301243	Bmd2_m	bone mineral density 2 (mouse)			Not determined		5	55388334	100455525	Mouse
4142317	Rgcs1_m	retinal ganglion cell susceptible 1 (mouse)			Not determined			55388334	108762627	Mouse
11040591	Lmr3c_m	leishmaniasis resistance 3c (mouse)					5	59602801	93602980	Mouse
11040592	Lmr3d_m	leishmaniasis resistance 3d (mouse)					5	59602801	93602980	Mouse
11040589	Lmr3a_m	leishmaniasis resistance 3a (mouse)					5	59602801	93602980	Mouse
11040590	Lmr3b_m	leishmaniasis resistance 3b (mouse)					5	59602801	93602980	Mouse
1301843	Listr1_m	listeriosis resistance 1 (mouse)			Not determined		5	60246081	94246203	Mouse
13464247	Ahl14_m	age related hearing loss, early onset 14 (mouse)					5	60403062	94403160	Mouse
11252124	Modvl6_m	modifier of vacuolated lens 6 (mouse)					5	62650568	96650688	Mouse
4142428	Modvl1_m	modifier of vacuolated lens 1 (mouse)			Not determined			62650568	96650688	Mouse
1301010	ahl2_m	age related hearing loss 2 (mouse)			Not determined		5	62650568	96650688	Mouse
13464250	Ahl15_m	age related hearing loss, early onset 15 (mouse)					5	62650568	96650688	Mouse
10045972	Tir5_m	trypanosome infection response 5 (mouse)			Not determined		5	63705442	104387065	Mouse
11049560	Lmr24d_m	leishmaniasis resistance 24d (mouse)					5	64374877	98374996	Mouse
12904739	M2fscn2_m	modifier 2 of FSCN2 (mouse)					5	66529661	100529661	Mouse
12904740	M1fscn2_m	modifier 1 of Fscn2 (mouse)					5	66529661	100529661	Mouse
26884395	Humsd2_m	humerus midshaft diameter 2, 10 week (mouse)					5	70057343	132528839	Mouse
10043993	Hbnr10_m	Heligmosomoides bakeri nematode resistance 10 (mouse)			Not determined		5	72418876	106419011	Mouse
27226719	Tibw6_m	tibia width 6, proximal, 16 week (mouse)					5	72857343	139985755	Mouse
25314315	Mlh1fc4_m	MLH1 foci count 4 (mouse)					5	74460661	132528839	Mouse
13506928	Recrq8_m	recombination rate in male meiosis QTL 8 (mouse)					5	74460661	132528839	Mouse
4141124	Dshv2_m	dorsal hippocampal volume 2 (mouse)			Not determined		5	75315348	98019803	Mouse
1357431	Cia27_m	collagen induced arthritis 27 (mouse)			Not determined		5	75315348	120018629	Mouse
4141438	Skmw13_m	skeletal muscle weight 13 (mouse)			Not determined		5	76190263	110190479	Mouse
4141505	Chlq14_m	circulating hormone level QTL 14 (mouse)			Not determined		5	76280786	110280917	Mouse
1300986	Hdlq2_m	HDL QTL 2 (mouse)			Not determined		5	76280786	110280917	Mouse
1301691	Cdcs10_m	cytokine deficiency colitis susceptibility 10 (mouse)			Not determined		5	76280786	110280917	Mouse
1301829	Thyls2_m	thymic lymphoma susceptibility 2 (mouse)			Not determined		5	76445064	110445225	Mouse
1301713	Dbsty2_m	diabesity 2 (mouse)			Not determined		5	76445064	110445225	Mouse
13464249	Ahl16_m	age related hearing loss, early onset 16 (mouse)					5	76445064	110445225	Mouse
1300931	Cocrb6_m	cocaine related behavior 6 (mouse)			Not determined		5	76445064	110445225	Mouse
12910784	Pwgrq15_m	post-weaning growth rate QTL 15 (mouse)					5	77175823	97658215	Mouse
12910816	Ogrq2_m	overall growth rate QTL 2 (mouse)					5	77175823	97658215	Mouse
10401246	Bglu13_m	blood glucose level 13 (mouse)			Not determined		5	79539640	113539786	Mouse
10755524	Mono1_m	monocyte differential 1 (mouse)					5	80849259	114849259	Mouse
1301419	Cypr3_m	cytokine production 3 (mouse)			Not determined		5	81019649	115019803	Mouse
10401245	Bglu18_m	blood glucose level 18 (mouse)			Not determined		5	82838468	116838597	Mouse
13464242	Ahl17_m	age related hearing loss, early onset 17 (mouse)					5	82838468	116838597	Mouse
10043958	Chldq12_m	cholesterol and HDL QTL 12 (mouse)			Not determined		5	87386871	121387065	Mouse
1301126	Bwem1_m	body weight day 30 males 1 (mouse)			Not determined		5	87386871	121387065	Mouse
13464241	Ahl18_m	age related hearing loss, early onset 18 (mouse)					5	87386871	121387065	Mouse
1300801	Drb2_m	dopamine receptor binding 2 (mouse)			Not determined		5	87386871	121387065	Mouse
1301399	Cpfd3_m	cerebellum pattern fissures (mouse)			Not determined		5	87386871	121387065	Mouse
1357725	Eae39_m	experimental allergic encephalomyelitis 39 (mouse)			Not determined		5	89418876	118864028	Mouse
1300968	Skts4_m	skin tumor susceptibility 4 (mouse)			Not determined		5	89418876	124238239	Mouse
1301362	Prnr1_m	prion resistance 1 (mouse)			Not determined		5	89418876	146787935	Mouse
11049562	Lmr24f_m	leishmaniasis resistance 24f (mouse)					5	90320962	124321041	Mouse
1301457	Cfsw2_m	cystic fibrosis survival to weaning 2 (mouse)			Not determined		5	90561006	124561151	Mouse
1300993	Hycdc_m	hypercapnic duty cycle (mouse)			Not determined		5	90561006	124561151	Mouse
9587780	Afw16_m	abdominal fat weight QTL 16 (mouse)			Not determined		5	92830166	126830285	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	XR_003955751	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC125233	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XR_003955751

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	5	93,185,550 - 93,188,741 (+)	NCBI
GRCm38	5	93,037,691 - 93,040,882 (+)	NCBI

Sequence:

show sequence

TGCCGAGAGGCAAGTGAAGCCGCTCCACCTGCCTCTGATCTTCCAGGTGGTCTTGAAGAAGCTT
AGAGGAATAAACAAGCATCTGGGCCCAGGAGCCCTGGAGGTGTAAGGCTTTCAGGCTGTCCCAG
GGGAGGAACTTCTGTGGTTATGAAGCCAGCTGCCTCTTGCCGTCCTTTCTACGAATCCATGAGA
AGTTGGGTTCACATCCGGGAGAAGCCAGCAGAAGGCTGGAAGAGCATTCCTGCCCAAGTCCTCT
CCACCTGGACTTTGCAACCTGAGCAAGAGCCTGAGCTCTTTCACCCTGCCCTGCCCCCACCAGC
ACTGTGACTGTGTGAGACAGTTCACCCGATGATCACTATAGTGTGGAGCCACACTGAAGCAGAC
GACAAGAATGTGGAGGAACCAACAAAGCTGGTTTCCTGGGAAGGCCAGTATCATCACTCCTGGA
CAGAACCAAGCCCAGCTTCTTTTCCCTTCCCCTTCTCTCTGCCTGCCTTCCTCCCTCCCCTCCT
CCCACCCCCAACATTTAGTTTTTTAGTTGGTACTCATTCTTGACACATACACCCCTTCTTCCTC
CTGCCTATTAGTACAAGCTTCTCTCTGTTGTAATGAGGCTTTGAAAGACAACCTGGGAACAAGT
CAAGGTAAAAAACAGCCAAGAGCAAATAGTTTAGGGTTTTAGCTCCTAGTGAAGAGACAGCCTG
TCAACCTGTCCCACTCACCTTTAAAAACCCCACAGAGTTGTGCAGAGTATGTGTTGAATAATCT
GATCTTGCTTCACAATGTGTTAGATCCACTGGCTCTTAAAAGAAGCTGTTTGCTAGATTATTTT
CATAACTGTCTGTTTTGTAAACTTAAATTTACA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
MGD	MGI:6367171	ENTREZGENE
NCBI Gene	Gm52780	ENTREZGENE
PhenoGen	Gm52780	PhenoGen

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message