Gm47209 (predicted gene, 47209) - Rat Genome Database

Name: Gm47209
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Gm47209 (predicted gene, 47209) Mus musculus

Analyze

Symbol:

Gm47209

Name:

predicted gene, 47209

RGD ID:

15002785

MGI Page

MGI

Description:

ASSOCIATED WITH COVID-19 (ortholog)

Type:

pseudo

RefSeq Status:

INFERRED

Also known as:

LOW QUALITY PROTEIN: reelin domain-containing protein 1; Reeld1; reeler domain containing 1

RGD Orthologs

Human

Bonobo

Dog

Pig

Green Monkey

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	79,481,591 - 79,501,279 (-)	NCBI	GRCm39		mm39
GRCm38	8	78,754,962 - 78,774,650 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	78,754,916 - 78,774,545 (-)	Ensembl	GRCm38		mm10	GRCm38
Cytogenetic Map	8	C1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

COVID-19 (ISO)

References

Genomics

Comparative Map Data

Gm47209
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	79,481,591 - 79,501,279 (-)	NCBI	GRCm39		mm39
GRCm38	8	78,754,962 - 78,774,650 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	78,754,916 - 78,774,545 (-)	Ensembl	GRCm38		mm10	GRCm38
Cytogenetic Map	8	C1	NCBI

REELD1
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	4	146,214,515 - 146,230,878 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	4	146,214,538 - 146,232,267 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	4	147,144,753 - 147,152,027 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	4	147,357,561 - 147,371,115 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	4	144,457,570 - 144,471,492 (+)	NCBI
Cytogenetic Map	4	q31.22	NCBI
HuRef	4	142,865,569 - 142,872,843 (+)	NCBI		HuRef
CHM1_1	4	147,113,208 - 147,129,314 (+)	NCBI		CHM1_1

REELD1
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
PanPan1.1	4	150,210,238 - 150,226,469 (+)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	4	150,212,539 - 150,226,107 (+)	Ensembl	panpan1.1		panPan2
Mhudiblu_PPA_v0	4	138,538,279 - 138,569,115 (+)	NCBI	Mhudiblu_PPA_v0		panPan3

REELD1
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	15	44,691,012 - 44,698,702 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1

LOC102167861
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	8	82,380,149 - 82,395,384 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	8	82,379,126 - 82,401,525 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	8	87,678,764 - 87,700,538 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

REELD1
(Chlorocebus sabaeus - African green monkey)

Vervet Assembly	Chr	Position (strand)	Source	Genome Browsers
Vervet Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	7	92,760,101 - 92,777,208 (+)	NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4140967	Bmd39_m	bone mineral density 39 (mouse)			Not determined		8	32016544	117238700	Mouse
1558875	Eae31_m	experimental allergic encephalomyelitis susceptibility 31 (mouse)			Not determined		8	34642776	114837007	Mouse
1301013	Capsq4_m	capsaicin sensitivity related QTL 4 (mouse)			Not determined		8	36163000	92728652	Mouse
27226754	Femd6_m	femur midshaft diameter 6, 10 week (mouse)					8	37400000	109600000	Mouse
12904744	Carcdq1_m	cardiac collagen deposition QTL 1 (mouse)					8	39709256	94689598	Mouse
1301717	Adip4_m	adiposity 4 (mouse)			Not determined		8	47637030	81637146	Mouse
10766453	Char11_m	P. chabaudi malaria resistance QTL 11 (mouse)					8	47637030	81637146	Mouse
1301441	Skull11_m	skull morphology 11 (mouse)			Not determined		8	47737134	81737254	Mouse
1357715	Alaa3_m	alopecia areata 3 (mouse)			Not determined		8	48792939	82793021	Mouse
14746987	Manh64_m	mandible shape 64 (mouse)					8	50053306	84053306	Mouse
14747005	Mancz7_m	mandible centroid size 7 (mouse)					8	50053306	84053306	Mouse
14700686	Civq3_m	cerebral infarct volume QTL 3 (mouse)					8	51882191	85882191	Mouse
1301506	Aevm1_m	autoimmune extremity vasculitis in MRL mice 1 (mouse)			Not determined		8	54287817	88287993	Mouse
1301952	Im3_m	immunoregulatory 3 (mouse)			Not determined		8	54706614	88706763	Mouse
10412287	Carg3_m	Candida albicans resistance gene 3 (mouse)			Not determined		8	55545028	89545028	Mouse
11353828	Gf7_m	gonadal fat pad weight 7 (mouse)					8	58201479	92201479	Mouse
10043975	Obq31_m	obesity QTL 31 (mouse)			Not determined		8	58409776	92409776	Mouse
1301688	Orch6_m	autoimmune orchitis resistance 6 (mouse)			Not determined		8	60786850	94786976	Mouse
4141285	Tgq18_m	triglyceride QTL 18 (mouse)			Not determined			63460107	97460107	Mouse
4141797	Skmw16_m	skeletal muscle weight 16 (mouse)			Not determined		8	63939547	97939696	Mouse
1357787	Vtbt5_m	vertebral trabecular bone trait 5 (mouse)			Not determined		8	65357768	99357920	Mouse
10043992	Hbnr11_m	Heligmosomoides bakeri nematode resistance 11 (mouse)			Not determined		8	65600207	99600347	Mouse
10766466	Char12_m	P. chabaudi malaria resistance QTL 12 (mouse)					8	68269827	82600347	Mouse
1301767	Fcsa2_m	femoral cross-sectional area 2 (mouse)			Not determined		8	70305375	104305495	Mouse
4142283	Imraq2_m	immune response to AAV2 QTL 2 (mouse)			Not determined		8	70305375	104305495	Mouse
1558780	Idd22_m	insulin dependent diabetes susceptibility 22 (mouse)			Not determined		8	71102903	105103009	Mouse
4141395	Char2a_m	P. chabaudi malaria resistance QTL 2a (mouse)			Not determined			71136783	90202598	Mouse
4142023	W3q5_m	weight 3 weeks QTL 5 (mouse)			Not determined			71287817	123895615	Mouse
1357708	Orq1_m	ovulation rate QTL 1 (mouse)			Not determined		8	71287817	123895615	Mouse
1301872	Cd4ts3_m	CD4 T cell subset 3 (mouse)			Not determined		8	71396181	105396393	Mouse
1300920	Pitm3_m	prion incubation time 3 (mouse)			Not determined		8	73202495	107202598	Mouse
27095912	Pglq14_m	pelvic girdle length QTL 14, 16 week (mouse)					8	73400000	126100000	Mouse
1558890	Lith18_m	lithogenic gene 18 (mouse)			Not determined		8	75675517	109675623	Mouse
1357470	Obq16_m	obesity QTL 16 (mouse)			Not determined		8	75685348	109685497	Mouse
1301808	Nhdlq1_m	non-HDL QTL 1 (mouse)			Not determined		8	75685348	109685497	Mouse
1301874	Hdlq16_m	HDL QTL 16 (mouse)			Not determined		8	75685348	109685497	Mouse
10412234	Nhdlq14_m	non-HDL QTL 14 (mouse)			Not determined		8	75685348	109685497	Mouse
1301099	Cbm2_m	cerebellum weight 2 (mouse)			Not determined		8	78518613	112518703	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NG_067501	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC167022	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000218647

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	8	78,754,916 - 78,774,545 (-)	Ensembl

RefSeq Acc Id:

XM_030243885 ⟹ XP_030099745

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	8	78,754,887 - 78,755,539 (-)	NCBI

Sequence:

show sequence

ACTAGATGAAGATCTGCTCCTTTCACATCATTTTCTTTTGTAGGACAAGATGACAGCCTCTAAT
AGGTCTGTGATGGGCCCTGGTCCGCACATTGCTCATATTCCCAAGCCTCAGCAGGTTTGGTCTN
NCACTGTGAGTAGAGCTGAGGCCACTCCAAGCCCTGACTTCTGTACCTTGGGCACATCTGGGAG
CCAGTCAGACCCCTCAAAAGATTCTGATAGCTCTTTATATGAGACACAGCACAGGGAGNCAGAG
TGTGGAGAAGGCACTGCAGAGGATGGTATGGGATACCTTAGCAAGACTGACCTAAGGCCTGAGG
TAATGCTAGAGGGAGCCGGTGCCTCTTTGGTGATGCAGCTCAGGACTCCACAGCTGGGAATCCT
GATTTGCTTGTCAATCACCCTGGGTGTGGCTCTGGCTGCTGGACTTTGCTTTCTGTATCCTCAG
TGTTGCCACAAGCGGACAGAAGGGTCCCCCAGTGAACCTACGGCAGATGCTGTTGACAACAGGG
AGGTGGTGCATGTCAGGAGGACAGGTGATAATAGTCTTTCCGTAGGGAACAAGAATCTTGTCCT
CTCAAGAGACCCTTGGACTGGGCCCCTCAGTGGCTCCACAGAGGGTCTTAGTCAAAAACGAGCT
AATGAGAATTCCTGA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000112190	Ensembl
MGD	MGI:6096013	ENTREZGENE
NCBI Gene	Gm47209	ENTREZGENE
PhenoGen	Gm47209	PhenoGen

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)