Ahr<sup>em1Soar</sup> (aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Ahrem1Soar (aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar) Rattus norvegicus
Analyze
Symbol: Ahrem1Soar
Name: aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar
RGD ID: 13702081
Description: CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands.
ASSOCIATED WITH decreased circulating anti-Mullerian hormone level; decreased physiological sensitivity to xenobiotic; decreased susceptibility to xenobiotic induced morbidity/mortality
Type: allele  of Ahr  
Previously known as: Ahr^[em1Soar]
Is Marker For: Strains:   SD-Ahrem1Soar  
Latest Assembly: GRCr8 - GRCr8 Assembly
Position: No map positions available.


References

References - curated
# Reference Title Reference Citation
1. Evaluation of Placentation and the Role of the Aryl Hydrocarbon Receptor Pathway in a Rat Model of Dioxin Exposure. Iqbal K, etal., Environ Health Perspect. 2021 Nov;129(11):117001. doi: 10.1289/EHP9256. Epub 2021 Nov 8.
2. The Aryl hydrocarbon receptor mediates reproductive toxicity of polychlorinated biphenyl congener 126 in rats. Klenov V, etal., Toxicol Appl Pharmacol. 2021 Sep 1;426:115639. doi: 10.1016/j.taap.2021.115639. Epub 2021 Jul 10.

Genomics


Related Rat Strains
The following Strains have been annotated to Ahrem1Soar


Expression

RNA-SEQ Expression


Sequence

Nucleotide Sequences


Additional Information