MIR206 (microRNA 206) - Rat Genome Database

Name: MIR206
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR206 (microRNA 206) Homo sapiens

Analyze

Symbol:

MIR206

Name:

microRNA 206

RGD ID:

1352988

HGNC Page

HGNC:31584

Description:

Enables mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Involved in several processes, including negative regulation of cell adhesion molecule production; negative regulation of cell migration involved in sprouting angiogenesis; and regulation of gene expression. Acts upstream of or within positive regulation of gene expression. Part of RISC complex. Implicated in stomach cancer. Biomarker of stomach cancer.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

mir-206; MIRN206; miRNA206

RGD Orthologs

Alliance Genes

More Info

more info ...

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	6	52,144,349 - 52,144,434 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	6	52,144,349 - 52,144,434 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	6	52,009,147 - 52,009,232 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	6	52,117,105 - 52,117,190 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	6	53,670,284 - 53,670,369 (+)	NCBI		Celera
Cytogenetic Map	6	p12.2	NCBI
HuRef	6	51,840,140 - 51,840,225 (+)	NCBI		HuRef
CHM1_1	6	52,011,355 - 52,011,440 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	6	51,983,057 - 51,983,142 (+)	NCBI		T2T-CHM13v2.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

alcohol use disorder (ISO)

amyotrophic lateral sclerosis (EXP)

Breast Neoplasms (EXP)

Disease Progression (EXP)

Experimental Liver Neoplasms (EXP)

Hirschsprung's disease (EXP)

Myocardial Reperfusion Injury (EXP)

stomach cancer (IDA,IEP)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (EXP)

2,5-hexanedione (ISO)

3-methylcholanthrene (ISO)

6-propyl-2-thiouracil (ISO)

atorvastatin calcium (ISO)

atrazine (ISO)

benzo[a]pyrene (EXP)

bis(2-chloroethyl) sulfide (ISO)

cadmium atom (EXP)

cadmium dichloride (ISO)

carbon atom (EXP)

carbon nanotube (ISO)

ciprofloxacin (ISO)

cisplatin (EXP)

diphenylmethane-4,4'-diisocyanate (ISO)

elemental carbon (EXP)

ethanol (ISO)

gemfibrozil (ISO)

lead diacetate (ISO)

Licochalcone B (EXP)

lovastatin (ISO)

methanol (ISO)

methimazole (ISO)

methylmercury chloride (ISO)

perchlorate (ISO)

perfluorooctane-1-sulfonic acid (ISO)

pioglitazone (ISO)

progesterone (EXP)

quercetin (ISO)

resveratrol (EXP)

S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)

sodium arsenite (EXP)

sodium fluoride (ISO)

tetrachloromethane (ISO)

trichostatin A (ISO)

triclocarban (EXP)

triclosan (EXP)

valproic acid (ISO)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to estrogen stimulus (ISO)

cellular response to leukemia inhibitory factor (ISO)

miRNA-mediated gene silencing by mRNA destabilization (IDA)

miRNA-mediated post-transcriptional gene silencing (IDA,IEA)

negative regulation of cell adhesion molecule production (IDA)

negative regulation of cell migration involved in sprouting angiogenesis (IDA)

negative regulation of cholesterol efflux (IMP)

negative regulation of gene expression (IDA)

negative regulation of interleukin-6 production (IDA)

negative regulation of lipid biosynthetic process (IGI)

negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (IMP)

positive regulation of amyloid-beta formation (IDA)

positive regulation of cell fate commitment (ISS)

positive regulation of cholesterol efflux (IMP)

positive regulation of gene expression (IDA)

positive regulation of interleukin-1 beta production (IDA)

positive regulation of myotube differentiation (ISS)

positive regulation of neuroinflammatory response (IDA)

positive regulation of tumor necrosis factor production (IDA)

sensory perception of sound (ISO)

Cellular Component

nucleus (ISO)

RISC complex (IEA,IGI)

Molecular Function

mRNA 3'-UTR binding (IDA)

mRNA base-pairing translational repressor activity (IDA)

protein binding (IPI)

References

References - curated

#	Reference Title	Reference Citation
1.	Differential correlation of serum BDNF and microRNA content in rats with rapid or late onset of heavy alcohol use.	Ehinger Y, etal., Addict Biol. 2020 Mar 5:e12890. doi: 10.1111/adb.12890.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
3.	Prognostic significance of combined microRNA-206 and CyclinD2 in gastric cancer patients after curative surgery: A retrospective cohort study.	Shi H, etal., Biomed Pharmacother. 2015 Apr;71:210-5. doi: 10.1016/j.biopha.2014.12.037. Epub 2015 Jan 9.
4.	miR-206 inhibits gastric cancer proliferation in part by repressing cyclinD2.	Zhang L, etal., Cancer Lett. 2013 May 10;332(1):94-101. doi: 10.1016/j.canlet.2013.01.023. Epub 2013 Jan 21.

Additional References at PubMed

PMID:12554859	PMID:16381832	PMID:17604727	PMID:18593897	PMID:19423651	PMID:19620785	PMID:19684618	PMID:19710019	PMID:19723635	PMID:20346098	PMID:20347265	PMID:20388878
PMID:20487562	PMID:20519629	PMID:20696132	PMID:21037258	PMID:21157919	PMID:21518959	PMID:21637854	PMID:21645416	PMID:21983130	PMID:22110210	PMID:22308266	PMID:22330340
PMID:22508046	PMID:22912879	PMID:22926857	PMID:23071643	PMID:23466356	PMID:23499676	PMID:23696595	PMID:23751352	PMID:23886177	PMID:23921124	PMID:24040336	PMID:24107628
PMID:24288551	PMID:24289491	PMID:24390803	PMID:24460924	PMID:24586506	PMID:24603323	PMID:24767015	PMID:24919811	PMID:24935473	PMID:25120799	PMID:25146754	PMID:25202123
PMID:25436301	PMID:25452104	PMID:25481410	PMID:25500542	PMID:25522678	PMID:25572712	PMID:25589731	PMID:25607234	PMID:25644430	PMID:25653235	PMID:25660363	PMID:25678853
PMID:25792468	PMID:25955685	PMID:26045823	PMID:26075299	PMID:26093295	PMID:26125274	PMID:26143374	PMID:26175229	PMID:26186594	PMID:26213997	PMID:26221902	PMID:26325180
PMID:26406866	PMID:26515696	PMID:26685009	PMID:26718123	PMID:26775359	PMID:26808577	PMID:26879016	PMID:26918941	PMID:26919096	PMID:27014910	PMID:27014911	PMID:27031991
PMID:27100732	PMID:27169691	PMID:27221739	PMID:27223121	PMID:27277332	PMID:27277678	PMID:27279635	PMID:27291149	PMID:27424800	PMID:27435395	PMID:27529242	PMID:27538595
PMID:27541266	PMID:27558109	PMID:27614739	PMID:27662297	PMID:27806334	PMID:27826039	PMID:27893428	PMID:27906963	PMID:27924503	PMID:27994218	PMID:28005074	PMID:28342807
PMID:28391353	PMID:28431233	PMID:28454844	PMID:28598253	PMID:28755962	PMID:28765968	PMID:28822708	PMID:28940993	PMID:28987947	PMID:29115490	PMID:29222472	PMID:29295729
PMID:29325455	PMID:29410711	PMID:29484422	PMID:29542173	PMID:29549926	PMID:29664235	PMID:29807226	PMID:29886033	PMID:29916897	PMID:29935234	PMID:29936177	PMID:29956750
PMID:29971911	PMID:29989852	PMID:30076726	PMID:30111166	PMID:30119190	PMID:30135139	PMID:30155690	PMID:30156374	PMID:30250188	PMID:30272362	PMID:30335896	PMID:30565392
PMID:30569129	PMID:30582709	PMID:30633352	PMID:30636484	PMID:30657558	PMID:30666838	PMID:30779067	PMID:30804229	PMID:30805592	PMID:30878364	PMID:30904818	PMID:30920079
PMID:30982495	PMID:31046876	PMID:31048362	PMID:31069797	PMID:31099134	PMID:31121484	PMID:31245877	PMID:31279225	PMID:31297902	PMID:31379181	PMID:31400488	PMID:31408569
PMID:31431298	PMID:31485634	PMID:31506061	PMID:31507089	PMID:31579977	PMID:31599407	PMID:31742336	PMID:31766231	PMID:31774373	PMID:31850679	PMID:31899480	PMID:32049790
PMID:32075715	PMID:32084582	PMID:32107418	PMID:32206066	PMID:32277852	PMID:32286127	PMID:32363688	PMID:32373955	PMID:32376265	PMID:32627519	PMID:32682951	PMID:32800545
PMID:32900244	PMID:32921119	PMID:33086901	PMID:33099847	PMID:33111654	PMID:33145343	PMID:33445560	PMID:33461610	PMID:33540574	PMID:33653250	PMID:33830643	PMID:33945391
PMID:33945508	PMID:33965771	PMID:34038520	PMID:34147072	PMID:34196215	PMID:34240323	PMID:34268933	PMID:34418889	PMID:34481913	PMID:34558643	PMID:35084640	PMID:35107852
PMID:35342753	PMID:35351345	PMID:35360546	PMID:35401927	PMID:35996513	PMID:36003063	PMID:36190650	PMID:36400383	PMID:36694220

Genomics

Comparative Map Data

MIR206
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	6	52,144,349 - 52,144,434 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	6	52,144,349 - 52,144,434 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	6	52,009,147 - 52,009,232 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	6	52,117,105 - 52,117,190 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	6	53,670,284 - 53,670,369 (+)	NCBI		Celera
Cytogenetic Map	6	p12.2	NCBI
HuRef	6	51,840,140 - 51,840,225 (+)	NCBI		HuRef
CHM1_1	6	52,011,355 - 52,011,440 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	6	51,983,057 - 51,983,142 (+)	NCBI		T2T-CHM13v2.0

Mir206
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	1	20,749,234 - 20,749,306 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	1	20,749,234 - 20,749,306 (+)	Ensembl		GRCm39 Ensembl
GRCm38	1	20,679,010 - 20,679,082 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	1	20,679,010 - 20,679,082 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	1	20,669,091 - 20,669,163 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	1	20,553,851 - 20,553,923 (+)	NCBI		Celera
Cytogenetic Map	1	A4	NCBI
cM Map	1	6.41	NCBI

Mir206
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	9	23,094,249 - 23,094,332 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	9	23,094,249 - 23,094,332 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	9	31,591,767 - 31,591,850 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	9	36,712,487 - 36,712,570 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	9	35,027,758 - 35,027,841 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	9	26,791,764 - 26,791,847 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	9	26,791,764 - 26,791,847 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	9	25,648,214 - 25,648,297 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	9	20,674,100 - 20,674,183 (+)	NCBI		Celera
Cytogenetic Map	9	q13	NCBI

MIR206
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	12	19,805,523 - 19,805,582 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	12	19,805,523 - 19,805,582 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	12	19,701,736 - 19,701,795 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	12	20,304,504 - 20,304,563 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	12	20,304,504 - 20,304,563 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	12	19,809,950 - 19,810,009 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	12	19,912,903 - 19,912,962 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	12	20,050,920 - 20,050,979 (+)	NCBI		UU_Cfam_GSD_1.0

MIR206
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	7	45,976,293 - 45,976,372 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	7	45,976,293 - 45,976,372 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	7	52,426,445 - 52,426,524 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 6p12.3-11.2(chr6:50971182-57432788)x1	copy number loss	See cases [RCV000134922]	Chr6:50971182..57432788 [GRCh38] Chr6:50938895..57297586 [GRCh37] Chr6:51046854..57405545 [NCBI36] Chr6:6p12.3-11.2	pathogenic
GRCh38/hg38 6p12.3-12.1(chr6:51093754-53859634)x4	copy number gain	See cases [RCV000137095]	Chr6:51093754..53859634 [GRCh38] Chr6:51061467..53724432 [GRCh37] Chr6:51169426..53832391 [NCBI36] Chr6:6p12.3-12.1	pathogenic
GRCh38/hg38 6p12.2(chr6:51803422-52698500)x1	copy number loss	See cases [RCV000136613]	Chr6:51803422..52698500 [GRCh38] Chr6:51668220..52563298 [GRCh37] Chr6:51776179..52671257 [NCBI36] Chr6:6p12.2	pathogenic
GRCh38/hg38 6p21.1-12.1(chr6:45681671-54212044)x1	copy number loss	See cases [RCV000138349]	Chr6:45681671..54212044 [GRCh38] Chr6:45649408..54076842 [GRCh37] Chr6:45757386..54184801 [NCBI36] Chr6:6p21.1-12.1	pathogenic\|uncertain significance
GRCh37/hg19 6p25.3-q27(chr6:156975-170919482)x3	copy number gain	See cases [RCV000512067]	Chr6:156975..170919482 [GRCh37] Chr6:6p25.3-q27	pathogenic
GRCh37/hg19 6p25.3-q27(chr6:156975-170919482)	copy number gain	See cases [RCV000510595]	Chr6:156975..170919482 [GRCh37] Chr6:6p25.3-q27	pathogenic
GRCh37/hg19 6p25.3-q27(chr6:60107-171054786)x3	copy number gain	not provided [RCV000745400]	Chr6:60107..171054786 [GRCh37] Chr6:6p25.3-q27	pathogenic
GRCh37/hg19 6p25.3-q27(chr6:108666-170980171)x3	copy number gain	not provided [RCV000745403]	Chr6:108666..170980171 [GRCh37] Chr6:6p25.3-q27	pathogenic
GRCh37/hg19 6p25.3-q27(chr6:165632-170919470)x3	copy number gain	not provided [RCV000745404]	Chr6:165632..170919470 [GRCh37] Chr6:6p25.3-q27	pathogenic
GRCh37/hg19 6p22.1-q14.1(chr6:29455465-81447367)	copy number gain	not provided [RCV000767714]	Chr6:29455465..81447367 [GRCh37] Chr6:6p22.1-q14.1	pathogenic
GRCh37/hg19 6p12.3-12.2(chr6:51637152-52303162)x3	copy number gain	not provided [RCV000849320]	Chr6:51637152..52303162 [GRCh37] Chr6:6p12.3-12.2	uncertain significance
GRCh37/hg19 6p12.3-12.2(chr6:51695623-52371918)	copy number loss	Autosomal recessive polycystic kidney disease [RCV001195156]	Chr6:51695623..52371918 [GRCh37] Chr6:6p12.3-12.2	pathogenic
GRCh37/hg19 6p12.3-12.1(chr6:48626041-55575545)x1	copy number loss	See cases [RCV001263045]	Chr6:48626041..55575545 [GRCh37] Chr6:6p12.3-12.1	likely pathogenic
NC_000006.11:g.(?_51930764)_(52906034_?)del	deletion	not provided [RCV001346439]	Chr6:51930764..52906034 [GRCh37] Chr6:6p12.2-12.1	uncertain significance
GRCh37/hg19 6p21.1-q12(chr6:43636308-64947206)x3	copy number gain	not provided [RCV002221457]	Chr6:43636308..64947206 [GRCh37] Chr6:6p21.1-q12	likely pathogenic

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
MET	hsa-miR-206	Mirtarbase	external_info	Western blot	Functional MTI	19620785
MET	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	19710019
MET	hsa-miR-206	Mirtarbase	external_info	qRT-PCR//ChIP//Luciferase reporter assay//Western	Functional MTI	20388878
NOTCH3	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot//	Functional MTI	19723635
ESR1	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot//	Functional MTI	17312270
ESR1	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay//Microarray	Functional MTI	19684618
ESR1	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay	Functional MTI	18593897
ESR1	hsa-miR-206	Mirtarbase	external_info	Immunoblot//Luciferase reporter assay//qRT-PCR	Non-Functional MTI	19414598
UTRN	hsa-miR-206	Mirtarbase	external_info	Reporter assay	Functional MTI	17030984
TAC1	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay//Reporter assay;Other	Functional MTI	17855557
PAX3	hsa-miR-206	Mirtarbase	external_info	ChIP-seq//Immunoblot//Luciferase reporter assay//q	Functional MTI	20956382
TPPP	hsa-miR-206	Mirtarbase	external_info	Immunoblot//Immunocytochemistry//Luciferase report	Functional MTI	19606501
CCND2	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay	Functional MTI	23348698
CCND2	hsa-miR-206	Mirtarbase	external_info	Luciferase reporter assay	Functional MTI	23466356
GJA1	hsa-miR-206	Mirtarbase	external_info	Western blot	Functional MTI	17062625
GJA1	hsa-miR-206	Tarbase	external_info	Westernblit	POSITIVE
TAC1	hsa-miR-206	Tarbase	external_info	Reporter Gene	POSITIVE
ESR1	hsa-miR-206	Tarbase	external_info	qPCR	NEGATIVE
GJA1	hsa-miR-206	Mirecords	external_info	NA	NA	18155131
TAC1	hsa-miR-206	Mirecords	external_info	NA	NA	17855557
ESR1	hsa-miR-206	Mirecords	external_info	{changed}{changed}	NA	17312270
MET	hsa-miR-206	Mirecords	external_info	NA	NA	19710019
ESR1	hsa-miR-206	Mirecords	external_info	NA	NA	19684618
CCND2	hsa-miR-206	OncomiRDB	external_info	NA	NA	23466356
OTX2	hsa-miR-206	OncomiRDB	external_info	NA	NA	22508046
MET	hsa-miR-206	OncomiRDB	external_info	NA	NA	20388878
NOTCH3	hsa-miR-206	OncomiRDB	external_info	NA	NA	19723635
MET	hsa-miR-206	OncomiRDB	external_info	NA	NA	19710019
ESR1	hsa-miR-206	OncomiRDB	external_info	NA	NA	19684618
ESR1	hsa-miR-206	OncomiRDB	external_info	NA	NA	17312270

Predicted Targets

	Summary Value
Count of predictions:	16228
Count of gene targets:	6462
Count of transcripts:	12098
Interacting mature miRNAs:	hsa-miR-206
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	adipose tissue	appendage
High
Medium							2	3						2
Low	3	1	3	2	19	2	10	8	4	24	6	9	2	8
Below cutoff	2	2	3		2		7	5	6	3	1		6	5

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029713	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL391221	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CP068272	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608529	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENST00000384872

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	6	52,144,349 - 52,144,434 (+)	Ensembl

RefSeq Acc Id:

NR_029713

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	6	52,144,349 - 52,144,434 (+)	NCBI
GRCh37	6	52,009,147 - 52,009,232 (+)	ENTREZGENE
HuRef	6	51,840,140 - 51,840,225 (+)	ENTREZGENE
CHM1_1	6	52,011,355 - 52,011,440 (+)	NCBI
T2T-CHM13v2.0	6	51,983,057 - 51,983,142 (+)	NCBI

Sequence:

show sequence

TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTATGGAATGTAAGG
AAGTGTGTGGTTTCGGCAAGTG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	HGNC:31584	AgrOrtholog
COSMIC	MIR206	COSMIC
Ensembl Genes	ENSG00000207604	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000384872	ENTREZGENE
GTEx	ENSG00000207604	GTEx
HGNC ID	HGNC:31584	ENTREZGENE
Human Proteome Map	MIR206	Human Proteome Map
miRBase	MI0000490	ENTREZGENE
NCBI Gene	406989	ENTREZGENE
OMIM	611599	OMIM
PharmGKB	PA164722585	PharmGKB
RNAcentral	URS000034B6F5	RNACentral
	URS0000389B41	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD